Incidental Mutation 'R1087:F830045P16Rik'
ID85058
Institutional Source Beutler Lab
Gene Symbol F830045P16Rik
Ensembl Gene ENSMUSG00000043727
Gene NameRIKEN cDNA F830045P16 gene
SynonymsSirpb3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R1087 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location129458359-129536602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129472719 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 213 (T213A)
Ref Sequence ENSEMBL: ENSMUSP00000058047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050309]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050309
AA Change: T213A

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000058047
Gene: ENSMUSG00000043727
AA Change: T213A

DomainStartEndE-ValueType
IG_like 51 123 7.95e-2 SMART
IGc1 156 227 5.66e-4 SMART
Pfam:C2-set_2 264 331 1.6e-6 PFAM
IGc1 359 432 2.28e-7 SMART
transmembrane domain 460 482 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T C 18: 57,730,798 S225P probably damaging Het
Anxa11 A G 14: 25,870,179 M56V unknown Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Atp8b3 T C 10: 80,520,183 R1232G probably benign Het
Axdnd1 T A 1: 156,365,689 M643L probably benign Het
Bsph1 A G 7: 13,472,181 Y57C probably damaging Het
Car13 G A 3: 14,641,825 W6* probably null Het
Ccng2 T C 5: 93,273,444 I271T probably benign Het
Ces1f T A 8: 93,258,295 D468V probably damaging Het
Chil4 A G 3: 106,210,565 Y130H probably benign Het
Clns1a T A 7: 97,705,655 H69Q possibly damaging Het
Cnot11 T A 1: 39,540,058 S335T probably benign Het
Dcaf11 A G 14: 55,569,124 S461G probably damaging Het
Dlst G A 12: 85,132,639 M417I probably damaging Het
Dock4 A C 12: 40,729,938 I612L probably benign Het
Endod1 A G 9: 14,357,193 V332A possibly damaging Het
Gm5773 A T 3: 93,773,758 I246F probably damaging Het
Gml2 T A 15: 74,824,097 D113E possibly damaging Het
Grik1 T C 16: 88,006,377 E309G probably benign Het
Hectd1 A T 12: 51,776,572 I1013K probably damaging Het
Kcmf1 T C 6: 72,858,880 E22G probably damaging Het
Kdm5b T A 1: 134,600,637 C361S probably damaging Het
Kif21b T C 1: 136,162,823 S1150P probably damaging Het
Man2b1 G A 8: 85,095,171 V701M probably damaging Het
March10 T C 11: 105,390,662 R266G probably damaging Het
Milr1 A G 11: 106,755,022 Y130C probably damaging Het
Nampt A G 12: 32,833,043 T76A possibly damaging Het
Nek10 A G 14: 14,827,059 N86D possibly damaging Het
Nms T G 1: 38,944,111 probably null Het
Olfr1490 T A 19: 13,655,012 C194* probably null Het
Parp14 A G 16: 35,858,288 S437P probably damaging Het
Pif1 A G 9: 65,589,095 M226V probably benign Het
Rnf169 T C 7: 99,942,997 R216G probably benign Het
Rorb T C 19: 18,960,414 K307R probably damaging Het
Scube2 T C 7: 109,831,675 D439G probably damaging Het
Serpinb8 T C 1: 107,606,997 V266A probably damaging Het
Strip2 A G 6: 29,927,634 E226G probably damaging Het
Trim23 A G 13: 104,188,110 D212G possibly damaging Het
Vmn1r172 T A 7: 23,660,248 V186D possibly damaging Het
Vwde A T 6: 13,186,804 C895S probably damaging Het
Zswim8 C A 14: 20,717,865 probably null Het
Other mutations in F830045P16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:F830045P16Rik APN 2 129460529 missense probably damaging 0.97
IGL01149:F830045P16Rik APN 2 129460312 critical splice donor site probably null
IGL01556:F830045P16Rik APN 2 129463720 missense probably benign 0.01
IGL01690:F830045P16Rik APN 2 129472694 missense probably damaging 1.00
IGL02169:F830045P16Rik APN 2 129463572 missense probably damaging 1.00
IGL03194:F830045P16Rik APN 2 129460320 missense possibly damaging 0.91
IGL03231:F830045P16Rik APN 2 129460473 missense probably damaging 1.00
R0062:F830045P16Rik UTSW 2 129463704 missense possibly damaging 0.94
R0062:F830045P16Rik UTSW 2 129463704 missense possibly damaging 0.94
R0234:F830045P16Rik UTSW 2 129463464 missense possibly damaging 0.85
R0234:F830045P16Rik UTSW 2 129463464 missense possibly damaging 0.85
R0333:F830045P16Rik UTSW 2 129472857 missense probably damaging 0.96
R0479:F830045P16Rik UTSW 2 129472688 missense possibly damaging 0.86
R0550:F830045P16Rik UTSW 2 129463509 missense probably damaging 1.00
R0827:F830045P16Rik UTSW 2 129472776 missense probably benign 0.01
R1142:F830045P16Rik UTSW 2 129460332 nonsense probably null
R1642:F830045P16Rik UTSW 2 129463714 missense probably benign 0.00
R2022:F830045P16Rik UTSW 2 129472665 missense probably damaging 1.00
R2044:F830045P16Rik UTSW 2 129459397 missense possibly damaging 0.68
R4008:F830045P16Rik UTSW 2 129463547 missense probably damaging 1.00
R4009:F830045P16Rik UTSW 2 129463547 missense probably damaging 1.00
R4011:F830045P16Rik UTSW 2 129463547 missense probably damaging 1.00
R4212:F830045P16Rik UTSW 2 129460353 missense probably benign 0.00
R4579:F830045P16Rik UTSW 2 129463503 missense probably damaging 0.97
R4838:F830045P16Rik UTSW 2 129460550 missense possibly damaging 0.95
R5190:F830045P16Rik UTSW 2 129472715 missense probably benign 0.01
R5217:F830045P16Rik UTSW 2 129463573 missense probably damaging 1.00
R5297:F830045P16Rik UTSW 2 129460553 missense probably benign 0.10
R5352:F830045P16Rik UTSW 2 129472901 missense probably damaging 0.98
R6063:F830045P16Rik UTSW 2 129474390 missense probably damaging 1.00
R6072:F830045P16Rik UTSW 2 129472694 missense probably damaging 1.00
R6173:F830045P16Rik UTSW 2 129463668 missense probably damaging 1.00
R6383:F830045P16Rik UTSW 2 129536438 missense probably benign 0.04
R6386:F830045P16Rik UTSW 2 129472818 missense probably damaging 1.00
R6425:F830045P16Rik UTSW 2 129460580 missense probably damaging 1.00
R6699:F830045P16Rik UTSW 2 129460421 missense probably damaging 0.98
R6869:F830045P16Rik UTSW 2 129474561 missense probably damaging 0.99
R7751:F830045P16Rik UTSW 2 129460447 missense probably damaging 1.00
R8012:F830045P16Rik UTSW 2 129474432 missense possibly damaging 0.92
R8097:F830045P16Rik UTSW 2 129463585 missense possibly damaging 0.55
Z1176:F830045P16Rik UTSW 2 129536530 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CATACAGTGGGAGTGGCTCTTCAAG -3'
(R):5'- GACCCAGAGATCCAAGATCATGTGC -3'

Sequencing Primer
(F):5'- CAAGAGCATCCTCTCTGGGAAG -3'
(R):5'- TGTGCATCAAAAAGTGAACCTGAC -3'
Posted On2013-11-18