Mutagenetix > Incidental Mutation

Incidental Mutation 'R1087:Chil4'

85061

Institutional Source

Beutler Lab

Gene Symbol

Chil4

Ensembl Gene

ENSMUSG00000063779

Gene Name

chitinase-like 4

Synonyms

Ym2, Chi3l4

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1087 (G1)

Quality Score

114

Status

Not validated

Chromosome

Chromosomal Location

106201490-106219507 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 106210565 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 130 (Y130H)

Ref Sequence

ENSEMBL: ENSMUSP00000080851 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082219]

AlphaFold

Q91Z98

Predicted Effect

probably benign
Transcript: ENSMUST00000082219
AA Change: Y130H

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000080851
Gene: ENSMUSG00000063779
AA Change: Y130H

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Glyco_18	22	365	1.77e-132	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196128

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011I03Rik	T	C	18: 57,730,798	S225P	probably damaging	Het
Anxa11	A	G	14: 25,870,179	M56V	unknown	Het
Arid4a	G	A	12: 71,075,338	S509N	probably benign	Het
Atp8b3	T	C	10: 80,520,183	R1232G	probably benign	Het
Axdnd1	T	A	1: 156,365,689	M643L	probably benign	Het
Bsph1	A	G	7: 13,472,181	Y57C	probably damaging	Het
Car13	G	A	3: 14,641,825	W6*	probably null	Het
Ccng2	T	C	5: 93,273,444	I271T	probably benign	Het
Ces1f	T	A	8: 93,258,295	D468V	probably damaging	Het
Clns1a	T	A	7: 97,705,655	H69Q	possibly damaging	Het
Cnot11	T	A	1: 39,540,058	S335T	probably benign	Het
Dcaf11	A	G	14: 55,569,124	S461G	probably damaging	Het
Dlst	G	A	12: 85,132,639	M417I	probably damaging	Het
Dock4	A	C	12: 40,729,938	I612L	probably benign	Het
Endod1	A	G	9: 14,357,193	V332A	possibly damaging	Het
F830045P16Rik	T	C	2: 129,472,719	T213A	possibly damaging	Het
Gm5773	A	T	3: 93,773,758	I246F	probably damaging	Het
Gml2	T	A	15: 74,824,097	D113E	possibly damaging	Het
Grik1	T	C	16: 88,006,377	E309G	probably benign	Het
Hectd1	A	T	12: 51,776,572	I1013K	probably damaging	Het
Kcmf1	T	C	6: 72,858,880	E22G	probably damaging	Het
Kdm5b	T	A	1: 134,600,637	C361S	probably damaging	Het
Kif21b	T	C	1: 136,162,823	S1150P	probably damaging	Het
Man2b1	G	A	8: 85,095,171	V701M	probably damaging	Het
March10	T	C	11: 105,390,662	R266G	probably damaging	Het
Milr1	A	G	11: 106,755,022	Y130C	probably damaging	Het
Nampt	A	G	12: 32,833,043	T76A	possibly damaging	Het
Nek10	A	G	14: 14,827,059	N86D	possibly damaging	Het
Nms	T	G	1: 38,944,111		probably null	Het
Olfr1490	T	A	19: 13,655,012	C194*	probably null	Het
Parp14	A	G	16: 35,858,288	S437P	probably damaging	Het
Pif1	A	G	9: 65,589,095	M226V	probably benign	Het
Rnf169	T	C	7: 99,942,997	R216G	probably benign	Het
Rorb	T	C	19: 18,960,414	K307R	probably damaging	Het
Scube2	T	C	7: 109,831,675	D439G	probably damaging	Het
Serpinb8	T	C	1: 107,606,997	V266A	probably damaging	Het
Strip2	A	G	6: 29,927,634	E226G	probably damaging	Het
Trim23	A	G	13: 104,188,110	D212G	possibly damaging	Het
Vmn1r172	T	A	7: 23,660,248	V186D	possibly damaging	Het
Vwde	A	T	6: 13,186,804	C895S	probably damaging	Het
Zswim8	C	A	14: 20,717,865		probably null	Het

Other mutations in Chil4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Chil4	APN	3	106201797	missense	probably benign
IGL02457:Chil4	APN	3	106214399	missense	probably benign
R1398:Chil4	UTSW	3	106219509	splice site	probably null
R1503:Chil4	UTSW	3	106206034	missense	probably benign
R1553:Chil4	UTSW	3	106203690	missense	probably benign	0.02
R1806:Chil4	UTSW	3	106210643	splice site	probably benign
R1873:Chil4	UTSW	3	106206098	missense	probably benign	0.00
R2069:Chil4	UTSW	3	106219455	missense	probably benign	0.16
R2100:Chil4	UTSW	3	106214347	missense	probably benign
R2370:Chil4	UTSW	3	106214300	nonsense	probably null
R2984:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R2985:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R3522:Chil4	UTSW	3	106203740	missense	probably benign	0.08
R3919:Chil4	UTSW	3	106202532	missense	probably benign	0.00
R4033:Chil4	UTSW	3	106214449	missense	probably damaging	1.00
R4181:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4184:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4301:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4347:Chil4	UTSW	3	106202828	missense	probably benign
R4391:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4395:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4418:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4483:Chil4	UTSW	3	106214362	missense	probably damaging	1.00
R4544:Chil4	UTSW	3	106210606	missense	probably damaging	0.97
R4887:Chil4	UTSW	3	106204144	missense	probably benign	0.01
R4949:Chil4	UTSW	3	106206092	missense	possibly damaging	0.83
R5076:Chil4	UTSW	3	106202597	missense	probably damaging	1.00
R5146:Chil4	UTSW	3	106202834	missense	probably benign	0.18
R5254:Chil4	UTSW	3	106219452	missense	probably benign	0.00
R5521:Chil4	UTSW	3	106203697	missense	possibly damaging	0.50
R5790:Chil4	UTSW	3	106202578	missense	probably benign	0.00
R5883:Chil4	UTSW	3	106210570	missense	possibly damaging	0.48
R6010:Chil4	UTSW	3	106214395	missense	probably damaging	1.00
R6257:Chil4	UTSW	3	106204096	missense	possibly damaging	0.84
R6269:Chil4	UTSW	3	106204171	missense	probably damaging	1.00
R6602:Chil4	UTSW	3	106210590	missense	probably benign	0.00
R7113:Chil4	UTSW	3	106202767	missense	probably damaging	1.00
R7113:Chil4	UTSW	3	106214348	missense	probably benign
R7188:Chil4	UTSW	3	106204159	missense	probably damaging	1.00
R7980:Chil4	UTSW	3	106202744	missense	probably damaging	1.00
R8810:Chil4	UTSW	3	106201805	missense	probably damaging	0.99
R9300:Chil4	UTSW	3	106202558	missense	probably benign	0.10
R9307:Chil4	UTSW	3	106204066	critical splice donor site	probably null
R9529:Chil4	UTSW	3	106211340	missense	probably damaging	1.00
X0067:Chil4	UTSW	3	106206034	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CAAGATGTTTCCTTTGTTGCCCCAG -3'
(R):5'- AATCAACTGTGAACTGTTTTGTGCCC -3'

Sequencing Primer
(F):5'- ggaaagttactcaaacactctctg -3'
(R):5'- CCAAGGTGTCCATGCCATAG -3'

Posted On

2013-11-18