Incidental Mutation 'R1087:Ccng2'
ID85063
Institutional Source Beutler Lab
Gene Symbol Ccng2
Ensembl Gene ENSMUSG00000029385
Gene Namecyclin G2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1087 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location93267257-93276231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93273444 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 271 (I271T)
Ref Sequence ENSEMBL: ENSMUSP00000113278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031331] [ENSMUST00000121127]
Predicted Effect probably benign
Transcript: ENSMUST00000031331
AA Change: I271T

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000031331
Gene: ENSMUSG00000029385
AA Change: I271T

DomainStartEndE-ValueType
CYCLIN 61 147 3.06e-15 SMART
low complexity region 218 237 N/A INTRINSIC
low complexity region 295 317 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121127
AA Change: I271T

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113278
Gene: ENSMUSG00000029385
AA Change: I271T

DomainStartEndE-ValueType
CYCLIN 61 147 3.06e-15 SMART
low complexity region 218 237 N/A INTRINSIC
low complexity region 295 317 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153260
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The eukaryotic cell cycle is governed by cyclin-dependent protein kinases (CDKs) whose activities are regulated by cyclins and CDK inhibitors. The 8 species of cyclins reported in mammals, cyclins A through H, share a conserved amino acid sequence of about 90 residues called the cyclin box. The amino acid sequence of cyclin G is well conserved among mammals. The nucleotide sequence of cyclin G1 and cyclin G2 are 53% identical. Unlike cyclin G1, cyclin G2 contains a C-terminal PEST protein destabilization motif, suggesting that cyclin G2 expression is tightly regulated through the cell cycle. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T C 18: 57,730,798 S225P probably damaging Het
Anxa11 A G 14: 25,870,179 M56V unknown Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Atp8b3 T C 10: 80,520,183 R1232G probably benign Het
Axdnd1 T A 1: 156,365,689 M643L probably benign Het
Bsph1 A G 7: 13,472,181 Y57C probably damaging Het
Car13 G A 3: 14,641,825 W6* probably null Het
Ces1f T A 8: 93,258,295 D468V probably damaging Het
Chil4 A G 3: 106,210,565 Y130H probably benign Het
Clns1a T A 7: 97,705,655 H69Q possibly damaging Het
Cnot11 T A 1: 39,540,058 S335T probably benign Het
Dcaf11 A G 14: 55,569,124 S461G probably damaging Het
Dlst G A 12: 85,132,639 M417I probably damaging Het
Dock4 A C 12: 40,729,938 I612L probably benign Het
Endod1 A G 9: 14,357,193 V332A possibly damaging Het
F830045P16Rik T C 2: 129,472,719 T213A possibly damaging Het
Gm5773 A T 3: 93,773,758 I246F probably damaging Het
Gml2 T A 15: 74,824,097 D113E possibly damaging Het
Grik1 T C 16: 88,006,377 E309G probably benign Het
Hectd1 A T 12: 51,776,572 I1013K probably damaging Het
Kcmf1 T C 6: 72,858,880 E22G probably damaging Het
Kdm5b T A 1: 134,600,637 C361S probably damaging Het
Kif21b T C 1: 136,162,823 S1150P probably damaging Het
Man2b1 G A 8: 85,095,171 V701M probably damaging Het
March10 T C 11: 105,390,662 R266G probably damaging Het
Milr1 A G 11: 106,755,022 Y130C probably damaging Het
Nampt A G 12: 32,833,043 T76A possibly damaging Het
Nek10 A G 14: 14,827,059 N86D possibly damaging Het
Nms T G 1: 38,944,111 probably null Het
Olfr1490 T A 19: 13,655,012 C194* probably null Het
Parp14 A G 16: 35,858,288 S437P probably damaging Het
Pif1 A G 9: 65,589,095 M226V probably benign Het
Rnf169 T C 7: 99,942,997 R216G probably benign Het
Rorb T C 19: 18,960,414 K307R probably damaging Het
Scube2 T C 7: 109,831,675 D439G probably damaging Het
Serpinb8 T C 1: 107,606,997 V266A probably damaging Het
Strip2 A G 6: 29,927,634 E226G probably damaging Het
Trim23 A G 13: 104,188,110 D212G possibly damaging Het
Vmn1r172 T A 7: 23,660,248 V186D possibly damaging Het
Vwde A T 6: 13,186,804 C895S probably damaging Het
Zswim8 C A 14: 20,717,865 probably null Het
Other mutations in Ccng2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01148:Ccng2 APN 5 93270887 missense probably damaging 0.99
IGL01289:Ccng2 APN 5 93273417 missense probably null 0.88
R0133:Ccng2 UTSW 5 93273381 missense probably benign 0.15
R0266:Ccng2 UTSW 5 93271289 splice site probably benign
R0346:Ccng2 UTSW 5 93270894 missense probably damaging 1.00
R0401:Ccng2 UTSW 5 93273413 missense possibly damaging 0.52
R1373:Ccng2 UTSW 5 93271055 splice site probably benign
R1696:Ccng2 UTSW 5 93273382 missense possibly damaging 0.90
R3727:Ccng2 UTSW 5 93274951 missense probably damaging 1.00
R5395:Ccng2 UTSW 5 93269398 missense possibly damaging 0.84
R6337:Ccng2 UTSW 5 93270921 missense probably benign
R6611:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7077:Ccng2 UTSW 5 93269340 missense possibly damaging 0.91
R7140:Ccng2 UTSW 5 93268755 missense probably benign 0.00
R7161:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7193:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7233:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7235:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7269:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7270:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7271:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7449:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7451:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7567:Ccng2 UTSW 5 93270872 missense probably benign 0.01
R7614:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7657:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7658:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7743:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7744:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7745:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7874:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7875:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7876:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7877:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7884:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R8053:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R8279:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R8282:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R8492:Ccng2 UTSW 5 93271454 missense probably damaging 1.00
R8503:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R8504:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R8528:Ccng2 UTSW 5 93269305 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- CTGGTGGGATCAGTCCAGATAGCA -3'
(R):5'- CTTATCTCAGGTGACAGGGAGGGG -3'

Sequencing Primer
(F):5'- ttagagacacttagcagccag -3'
(R):5'- gccttacctgctcagacac -3'
Posted On2013-11-18