Incidental Mutation 'R1087:Kcmf1'
ID85066
Institutional Source Beutler Lab
Gene Symbol Kcmf1
Ensembl Gene ENSMUSG00000055239
Gene Namepotassium channel modulatory factor 1
Synonyms1700094M07Rik, clone DEBT-91, Pmcf
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R1087 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location72841114-72899979 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72858880 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 22 (E22G)
Ref Sequence ENSEMBL: ENSMUSP00000144910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068697] [ENSMUST00000204598] [ENSMUST00000204708] [ENSMUST00000206378]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068697
AA Change: E73G

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000064410
Gene: ENSMUSG00000055239
AA Change: E73G

DomainStartEndE-ValueType
ZnF_ZZ 3 48 6.05e-14 SMART
ZnF_C2H2 78 101 3.16e-3 SMART
low complexity region 157 168 N/A INTRINSIC
low complexity region 175 192 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 331 340 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203431
Predicted Effect probably damaging
Transcript: ENSMUST00000204598
AA Change: E22G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144910
Gene: ENSMUSG00000055239
AA Change: E22G

DomainStartEndE-ValueType
ZnF_C2H2 27 50 1.4e-5 SMART
Blast:ZnF_C2H2 57 85 9e-6 BLAST
low complexity region 106 117 N/A INTRINSIC
low complexity region 124 141 N/A INTRINSIC
coiled coil region 173 208 N/A INTRINSIC
low complexity region 280 289 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204708
Predicted Effect possibly damaging
Transcript: ENSMUST00000206378
AA Change: E73G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit some perinatal and postnatal lethality but mice that survive to adulthood exhibit normal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T C 18: 57,730,798 S225P probably damaging Het
Anxa11 A G 14: 25,870,179 M56V unknown Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Atp8b3 T C 10: 80,520,183 R1232G probably benign Het
Axdnd1 T A 1: 156,365,689 M643L probably benign Het
Bsph1 A G 7: 13,472,181 Y57C probably damaging Het
Car13 G A 3: 14,641,825 W6* probably null Het
Ccng2 T C 5: 93,273,444 I271T probably benign Het
Ces1f T A 8: 93,258,295 D468V probably damaging Het
Chil4 A G 3: 106,210,565 Y130H probably benign Het
Clns1a T A 7: 97,705,655 H69Q possibly damaging Het
Cnot11 T A 1: 39,540,058 S335T probably benign Het
Dcaf11 A G 14: 55,569,124 S461G probably damaging Het
Dlst G A 12: 85,132,639 M417I probably damaging Het
Dock4 A C 12: 40,729,938 I612L probably benign Het
Endod1 A G 9: 14,357,193 V332A possibly damaging Het
F830045P16Rik T C 2: 129,472,719 T213A possibly damaging Het
Gm5773 A T 3: 93,773,758 I246F probably damaging Het
Gml2 T A 15: 74,824,097 D113E possibly damaging Het
Grik1 T C 16: 88,006,377 E309G probably benign Het
Hectd1 A T 12: 51,776,572 I1013K probably damaging Het
Kdm5b T A 1: 134,600,637 C361S probably damaging Het
Kif21b T C 1: 136,162,823 S1150P probably damaging Het
Man2b1 G A 8: 85,095,171 V701M probably damaging Het
March10 T C 11: 105,390,662 R266G probably damaging Het
Milr1 A G 11: 106,755,022 Y130C probably damaging Het
Nampt A G 12: 32,833,043 T76A possibly damaging Het
Nek10 A G 14: 14,827,059 N86D possibly damaging Het
Nms T G 1: 38,944,111 probably null Het
Olfr1490 T A 19: 13,655,012 C194* probably null Het
Parp14 A G 16: 35,858,288 S437P probably damaging Het
Pif1 A G 9: 65,589,095 M226V probably benign Het
Rnf169 T C 7: 99,942,997 R216G probably benign Het
Rorb T C 19: 18,960,414 K307R probably damaging Het
Scube2 T C 7: 109,831,675 D439G probably damaging Het
Serpinb8 T C 1: 107,606,997 V266A probably damaging Het
Strip2 A G 6: 29,927,634 E226G probably damaging Het
Trim23 A G 13: 104,188,110 D212G possibly damaging Het
Vmn1r172 T A 7: 23,660,248 V186D possibly damaging Het
Vwde A T 6: 13,186,804 C895S probably damaging Het
Zswim8 C A 14: 20,717,865 probably null Het
Other mutations in Kcmf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02903:Kcmf1 APN 6 72858883 missense possibly damaging 0.95
IGL03057:Kcmf1 APN 6 72843027 missense probably benign 0.02
IGL03372:Kcmf1 APN 6 72849563 missense probably damaging 0.99
IGL03098:Kcmf1 UTSW 6 72849584 start codon destroyed probably null
R0080:Kcmf1 UTSW 6 72850487 splice site probably null
R0082:Kcmf1 UTSW 6 72850487 splice site probably null
R0226:Kcmf1 UTSW 6 72842952 missense probably benign
R0402:Kcmf1 UTSW 6 72849585 start codon destroyed probably null
R0412:Kcmf1 UTSW 6 72848241 nonsense probably null
R0616:Kcmf1 UTSW 6 72850484 missense probably benign 0.08
R1383:Kcmf1 UTSW 6 72849582 missense possibly damaging 0.94
R1533:Kcmf1 UTSW 6 72843020 missense possibly damaging 0.49
R1544:Kcmf1 UTSW 6 72848229 missense probably benign
R2355:Kcmf1 UTSW 6 72850483 missense probably damaging 1.00
R2380:Kcmf1 UTSW 6 72858772 critical splice donor site probably null
R3103:Kcmf1 UTSW 6 72861847 missense probably damaging 1.00
R4533:Kcmf1 UTSW 6 72849591 missense probably damaging 1.00
R5450:Kcmf1 UTSW 6 72842930 nonsense probably null
R5927:Kcmf1 UTSW 6 72843005 missense possibly damaging 0.49
R6467:Kcmf1 UTSW 6 72843099 missense probably damaging 0.99
R7048:Kcmf1 UTSW 6 72849467 missense probably damaging 1.00
R7089:Kcmf1 UTSW 6 72842946 missense probably benign 0.26
R7089:Kcmf1 UTSW 6 72848306 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTAGCTTCAGCAACATCAAGAGTAACA -3'
(R):5'- CGGAGCTTAGGGAGATGTACTTGGTT -3'

Sequencing Primer
(F):5'- GAAGAGATGTTTCCGTGTAGC -3'
(R):5'- gccagggttacagagtgag -3'
Posted On2013-11-18