Incidental Mutation 'R1087:Bsph1'
ID85067
Institutional Source Beutler Lab
Gene Symbol Bsph1
Ensembl Gene ENSMUSG00000074378
Gene Namebinder of sperm protein homolog 1
SynonymsLOC330470
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R1087 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location13450841-13473449 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13472181 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 57 (Y57C)
Ref Sequence ENSEMBL: ENSMUSP00000096408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098811] [ENSMUST00000204715]
Predicted Effect probably damaging
Transcript: ENSMUST00000098811
AA Change: Y57C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096408
Gene: ENSMUSG00000074378
AA Change: Y57C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
FN2 39 82 1.36e-6 SMART
FN2 83 131 2.29e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204715
AA Change: Y47C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144997
Gene: ENSMUSG00000074378
AA Change: Y47C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
FN2 28 72 3.47e-6 SMART
FN2 73 121 2.29e-19 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the binder of sperm family. The encoded protein may be involved in sperm capacitation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T C 18: 57,730,798 S225P probably damaging Het
Anxa11 A G 14: 25,870,179 M56V unknown Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Atp8b3 T C 10: 80,520,183 R1232G probably benign Het
Axdnd1 T A 1: 156,365,689 M643L probably benign Het
Car13 G A 3: 14,641,825 W6* probably null Het
Ccng2 T C 5: 93,273,444 I271T probably benign Het
Ces1f T A 8: 93,258,295 D468V probably damaging Het
Chil4 A G 3: 106,210,565 Y130H probably benign Het
Clns1a T A 7: 97,705,655 H69Q possibly damaging Het
Cnot11 T A 1: 39,540,058 S335T probably benign Het
Dcaf11 A G 14: 55,569,124 S461G probably damaging Het
Dlst G A 12: 85,132,639 M417I probably damaging Het
Dock4 A C 12: 40,729,938 I612L probably benign Het
Endod1 A G 9: 14,357,193 V332A possibly damaging Het
F830045P16Rik T C 2: 129,472,719 T213A possibly damaging Het
Gm5773 A T 3: 93,773,758 I246F probably damaging Het
Gml2 T A 15: 74,824,097 D113E possibly damaging Het
Grik1 T C 16: 88,006,377 E309G probably benign Het
Hectd1 A T 12: 51,776,572 I1013K probably damaging Het
Kcmf1 T C 6: 72,858,880 E22G probably damaging Het
Kdm5b T A 1: 134,600,637 C361S probably damaging Het
Kif21b T C 1: 136,162,823 S1150P probably damaging Het
Man2b1 G A 8: 85,095,171 V701M probably damaging Het
March10 T C 11: 105,390,662 R266G probably damaging Het
Milr1 A G 11: 106,755,022 Y130C probably damaging Het
Nampt A G 12: 32,833,043 T76A possibly damaging Het
Nek10 A G 14: 14,827,059 N86D possibly damaging Het
Nms T G 1: 38,944,111 probably null Het
Olfr1490 T A 19: 13,655,012 C194* probably null Het
Parp14 A G 16: 35,858,288 S437P probably damaging Het
Pif1 A G 9: 65,589,095 M226V probably benign Het
Rnf169 T C 7: 99,942,997 R216G probably benign Het
Rorb T C 19: 18,960,414 K307R probably damaging Het
Scube2 T C 7: 109,831,675 D439G probably damaging Het
Serpinb8 T C 1: 107,606,997 V266A probably damaging Het
Strip2 A G 6: 29,927,634 E226G probably damaging Het
Trim23 A G 13: 104,188,110 D212G possibly damaging Het
Vmn1r172 T A 7: 23,660,248 V186D possibly damaging Het
Vwde A T 6: 13,186,804 C895S probably damaging Het
Zswim8 C A 14: 20,717,865 probably null Het
Other mutations in Bsph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03131:Bsph1 APN 7 13473087 missense probably damaging 1.00
R0334:Bsph1 UTSW 7 13450939 nonsense probably null
R0684:Bsph1 UTSW 7 13473063 missense probably damaging 1.00
R0701:Bsph1 UTSW 7 13472256 missense probably damaging 1.00
R0905:Bsph1 UTSW 7 13450914 start codon destroyed probably benign 0.33
R2189:Bsph1 UTSW 7 13470329 critical splice donor site probably null
R3427:Bsph1 UTSW 7 13472243 missense probably damaging 1.00
R4043:Bsph1 UTSW 7 13458276 critical splice donor site probably null
R4718:Bsph1 UTSW 7 13472182 nonsense probably null
R4726:Bsph1 UTSW 7 13472995 missense probably benign 0.00
R5571:Bsph1 UTSW 7 13450915 start codon destroyed probably null 0.86
R6852:Bsph1 UTSW 7 13470330 critical splice donor site probably null
R6903:Bsph1 UTSW 7 13458258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCTTGATGCTAGGCAGCTC -3'
(R):5'- CAGCAACAAAGAAGTTGTGTGCCTC -3'

Sequencing Primer
(F):5'- ctctcctttccatccttctgac -3'
(R):5'- TTTCACAACGGAAGTTGCTC -3'
Posted On2013-11-18