Incidental Mutation 'R1087:Vmn1r172'
ID85068
Institutional Source Beutler Lab
Gene Symbol Vmn1r172
Ensembl Gene ENSMUSG00000035523
Gene Namevomeronasal 1 receptor 172
SynonymsV1rd9, V3R9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R1087 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location23658316-23668447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23660248 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 186 (V186D)
Ref Sequence ENSEMBL: ENSMUSP00000133887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038694] [ENSMUST00000173101]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038694
AA Change: V186D

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041653
Gene: ENSMUSG00000035523
AA Change: V186D

DomainStartEndE-ValueType
Pfam:TAS2R 8 301 7.1e-9 PFAM
Pfam:7tm_1 30 268 3.6e-9 PFAM
Pfam:V1R 43 301 7.2e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173101
AA Change: V186D

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133887
Gene: ENSMUSG00000035523
AA Change: V186D

DomainStartEndE-ValueType
Pfam:TAS2R 8 301 7.2e-9 PFAM
Pfam:V1R 43 301 7.2e-18 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T C 18: 57,730,798 S225P probably damaging Het
Anxa11 A G 14: 25,870,179 M56V unknown Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Atp8b3 T C 10: 80,520,183 R1232G probably benign Het
Axdnd1 T A 1: 156,365,689 M643L probably benign Het
Bsph1 A G 7: 13,472,181 Y57C probably damaging Het
Car13 G A 3: 14,641,825 W6* probably null Het
Ccng2 T C 5: 93,273,444 I271T probably benign Het
Ces1f T A 8: 93,258,295 D468V probably damaging Het
Chil4 A G 3: 106,210,565 Y130H probably benign Het
Clns1a T A 7: 97,705,655 H69Q possibly damaging Het
Cnot11 T A 1: 39,540,058 S335T probably benign Het
Dcaf11 A G 14: 55,569,124 S461G probably damaging Het
Dlst G A 12: 85,132,639 M417I probably damaging Het
Dock4 A C 12: 40,729,938 I612L probably benign Het
Endod1 A G 9: 14,357,193 V332A possibly damaging Het
F830045P16Rik T C 2: 129,472,719 T213A possibly damaging Het
Gm5773 A T 3: 93,773,758 I246F probably damaging Het
Gml2 T A 15: 74,824,097 D113E possibly damaging Het
Grik1 T C 16: 88,006,377 E309G probably benign Het
Hectd1 A T 12: 51,776,572 I1013K probably damaging Het
Kcmf1 T C 6: 72,858,880 E22G probably damaging Het
Kdm5b T A 1: 134,600,637 C361S probably damaging Het
Kif21b T C 1: 136,162,823 S1150P probably damaging Het
Man2b1 G A 8: 85,095,171 V701M probably damaging Het
March10 T C 11: 105,390,662 R266G probably damaging Het
Milr1 A G 11: 106,755,022 Y130C probably damaging Het
Nampt A G 12: 32,833,043 T76A possibly damaging Het
Nek10 A G 14: 14,827,059 N86D possibly damaging Het
Nms T G 1: 38,944,111 probably null Het
Olfr1490 T A 19: 13,655,012 C194* probably null Het
Parp14 A G 16: 35,858,288 S437P probably damaging Het
Pif1 A G 9: 65,589,095 M226V probably benign Het
Rnf169 T C 7: 99,942,997 R216G probably benign Het
Rorb T C 19: 18,960,414 K307R probably damaging Het
Scube2 T C 7: 109,831,675 D439G probably damaging Het
Serpinb8 T C 1: 107,606,997 V266A probably damaging Het
Strip2 A G 6: 29,927,634 E226G probably damaging Het
Trim23 A G 13: 104,188,110 D212G possibly damaging Het
Vwde A T 6: 13,186,804 C895S probably damaging Het
Zswim8 C A 14: 20,717,865 probably null Het
Other mutations in Vmn1r172
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02295:Vmn1r172 APN 7 23659917 missense probably benign 0.30
IGL02407:Vmn1r172 APN 7 23659803 missense probably damaging 1.00
IGL02540:Vmn1r172 APN 7 23659925 missense probably benign 0.25
IGL03090:Vmn1r172 APN 7 23660038 missense probably damaging 0.98
R0396:Vmn1r172 UTSW 7 23660532 missense probably benign 0.06
R1502:Vmn1r172 UTSW 7 23660256 nonsense probably null
R1701:Vmn1r172 UTSW 7 23660104 missense probably damaging 1.00
R1882:Vmn1r172 UTSW 7 23660226 missense probably damaging 1.00
R2272:Vmn1r172 UTSW 7 23660191 missense probably damaging 0.98
R4646:Vmn1r172 UTSW 7 23660494 missense probably benign 0.03
R4653:Vmn1r172 UTSW 7 23660572 missense probably damaging 0.96
R4709:Vmn1r172 UTSW 7 23660181 missense probably benign 0.25
R4937:Vmn1r172 UTSW 7 23659887 missense possibly damaging 0.92
R4945:Vmn1r172 UTSW 7 23660320 missense possibly damaging 0.79
R5840:Vmn1r172 UTSW 7 23660175 missense probably benign 0.03
R6154:Vmn1r172 UTSW 7 23660158 missense probably damaging 0.96
R6317:Vmn1r172 UTSW 7 23660317 missense probably damaging 1.00
R7206:Vmn1r172 UTSW 7 23660157 missense possibly damaging 0.69
R7290:Vmn1r172 UTSW 7 23660623 missense unknown
R7362:Vmn1r172 UTSW 7 23660416 missense probably damaging 1.00
R7369:Vmn1r172 UTSW 7 23660605 missense unknown
R7528:Vmn1r172 UTSW 7 23659764 missense probably damaging 1.00
R7946:Vmn1r172 UTSW 7 23659432 splice site probably null
R8193:Vmn1r172 UTSW 7 23660327 nonsense probably null
R8540:Vmn1r172 UTSW 7 23660073 missense possibly damaging 0.79
R8863:Vmn1r172 UTSW 7 23659785 missense probably benign 0.08
U24488:Vmn1r172 UTSW 7 23659746 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACTTCATTCGTCTGGTGGCTCG -3'
(R):5'- GGGGAAACTTGCAGCCCAAATTC -3'

Sequencing Primer
(F):5'- GTGTCCTGAGCACTTACCAG -3'
(R):5'- TTGCAGCCCAAATTCCACTG -3'
Posted On2013-11-18