Incidental Mutation 'R1087:Clns1a'
ID85069
Institutional Source Beutler Lab
Gene Symbol Clns1a
Ensembl Gene ENSMUSG00000025439
Gene Namechloride channel, nucleotide-sensitive, 1A
SynonymsClci, ICLN, Clcni, 2610100O04Rik, 2610036D06Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1087 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location97696634-97720796 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97705655 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 69 (H69Q)
Ref Sequence ENSEMBL: ENSMUSP00000026506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026506]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026506
AA Change: H69Q

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026506
Gene: ENSMUSG00000025439
AA Change: H69Q

DomainStartEndE-ValueType
Pfam:Voldacs 40 168 1.2e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148125
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in multiple regulatory pathways. The encoded protein complexes with numerous cytosolic proteins and performs diverse functions including regulation of small nuclear ribonucleoprotein biosynthesis, platelet activation and cytoskeletal organization. The protein is also found associated with the plasma membrane where it functions as a chloride current regulator. Pseudogenes of this gene are found on chromosomes 1, 4 and 6. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous mutants die between E3.5-E7.5. Heterozygous mutants appear normal and healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T C 18: 57,730,798 S225P probably damaging Het
Anxa11 A G 14: 25,870,179 M56V unknown Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Atp8b3 T C 10: 80,520,183 R1232G probably benign Het
Axdnd1 T A 1: 156,365,689 M643L probably benign Het
Bsph1 A G 7: 13,472,181 Y57C probably damaging Het
Car13 G A 3: 14,641,825 W6* probably null Het
Ccng2 T C 5: 93,273,444 I271T probably benign Het
Ces1f T A 8: 93,258,295 D468V probably damaging Het
Chil4 A G 3: 106,210,565 Y130H probably benign Het
Cnot11 T A 1: 39,540,058 S335T probably benign Het
Dcaf11 A G 14: 55,569,124 S461G probably damaging Het
Dlst G A 12: 85,132,639 M417I probably damaging Het
Dock4 A C 12: 40,729,938 I612L probably benign Het
Endod1 A G 9: 14,357,193 V332A possibly damaging Het
F830045P16Rik T C 2: 129,472,719 T213A possibly damaging Het
Gm5773 A T 3: 93,773,758 I246F probably damaging Het
Gml2 T A 15: 74,824,097 D113E possibly damaging Het
Grik1 T C 16: 88,006,377 E309G probably benign Het
Hectd1 A T 12: 51,776,572 I1013K probably damaging Het
Kcmf1 T C 6: 72,858,880 E22G probably damaging Het
Kdm5b T A 1: 134,600,637 C361S probably damaging Het
Kif21b T C 1: 136,162,823 S1150P probably damaging Het
Man2b1 G A 8: 85,095,171 V701M probably damaging Het
March10 T C 11: 105,390,662 R266G probably damaging Het
Milr1 A G 11: 106,755,022 Y130C probably damaging Het
Nampt A G 12: 32,833,043 T76A possibly damaging Het
Nek10 A G 14: 14,827,059 N86D possibly damaging Het
Nms T G 1: 38,944,111 probably null Het
Olfr1490 T A 19: 13,655,012 C194* probably null Het
Parp14 A G 16: 35,858,288 S437P probably damaging Het
Pif1 A G 9: 65,589,095 M226V probably benign Het
Rnf169 T C 7: 99,942,997 R216G probably benign Het
Rorb T C 19: 18,960,414 K307R probably damaging Het
Scube2 T C 7: 109,831,675 D439G probably damaging Het
Serpinb8 T C 1: 107,606,997 V266A probably damaging Het
Strip2 A G 6: 29,927,634 E226G probably damaging Het
Trim23 A G 13: 104,188,110 D212G possibly damaging Het
Vmn1r172 T A 7: 23,660,248 V186D possibly damaging Het
Vwde A T 6: 13,186,804 C895S probably damaging Het
Zswim8 C A 14: 20,717,865 probably null Het
Other mutations in Clns1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00808:Clns1a APN 7 97716514 missense probably damaging 0.99
IGL03209:Clns1a APN 7 97711730 missense probably null 0.05
R0234:Clns1a UTSW 7 97714032 missense possibly damaging 0.93
R0234:Clns1a UTSW 7 97714032 missense possibly damaging 0.93
R1844:Clns1a UTSW 7 97696859 missense probably damaging 0.97
R2119:Clns1a UTSW 7 97713904 splice site probably null
R3797:Clns1a UTSW 7 97696835 missense probably benign 0.00
R4463:Clns1a UTSW 7 97720949 unclassified probably benign
R4810:Clns1a UTSW 7 97714017 missense probably benign 0.10
R5574:Clns1a UTSW 7 97720958 unclassified probably benign
R6608:Clns1a UTSW 7 97716468 missense probably benign 0.00
R7051:Clns1a UTSW 7 97712617 splice site probably null
R7384:Clns1a UTSW 7 97696781 missense probably benign 0.00
R8183:Clns1a UTSW 7 97705681 missense probably damaging 1.00
R8770:Clns1a UTSW 7 97713910 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACAGGTGACCTGAAATAACCTGCC -3'
(R):5'- TGAGCAGCCTGAAGACCTCATCTC -3'

Sequencing Primer
(F):5'- CCTGAAATAACCTGCCATTCAAATTG -3'
(R):5'- Tcaaacaaacaaacaaacaaacaaac -3'
Posted On2013-11-18