Incidental Mutation 'R1087:Scube2'
ID 85071
Institutional Source Beutler Lab
Gene Symbol Scube2
Ensembl Gene ENSMUSG00000007279
Gene Name signal peptide, CUB domain, EGF-like 2
Synonyms ICRFP703B1614Q5.1, Cegf1, ICRFP703N2430Q5.1, 4932442O19Rik
Accession Numbers
Essential gene? Possibly essential (E-score: 0.527) question?
Stock # R1087 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 109397897-109464886 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 109430882 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 439 (D439G)
Ref Sequence ENSEMBL: ENSMUSP00000102339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007423] [ENSMUST00000106728] [ENSMUST00000106729]
AlphaFold Q9JJS0
Predicted Effect probably damaging
Transcript: ENSMUST00000007423
AA Change: D439G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000007423
Gene: ENSMUSG00000007279
AA Change: D439G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 479 490 N/A INTRINSIC
low complexity region 577 594 N/A INTRINSIC
Pfam:GCC2_GCC3 642 692 7.2e-19 PFAM
Pfam:GCC2_GCC3 699 746 2e-16 PFAM
Pfam:GCC2_GCC3 755 802 3.1e-18 PFAM
CUB 807 919 1.23e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106728
AA Change: D439G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102339
Gene: ENSMUSG00000007279
AA Change: D439G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 451 468 N/A INTRINSIC
Pfam:GCC2_GCC3 516 566 6.4e-17 PFAM
Pfam:GCC2_GCC3 573 620 3.5e-14 PFAM
Pfam:GCC2_GCC3 629 676 5.4e-16 PFAM
Blast:CUB 678 727 2e-25 BLAST
Blast:CUB 730 796 1e-37 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000106729
AA Change: D439G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102340
Gene: ENSMUSG00000007279
AA Change: D439G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 605 622 N/A INTRINSIC
Pfam:GCC2_GCC3 670 717 1.8e-16 PFAM
Pfam:GCC2_GCC3 726 773 2.7e-18 PFAM
CUB 778 890 1.23e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132113
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are smaller than controls. Mice also exhibit defective endochondral bone formation and impaired Ihh-mediated chondrocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa11 A G 14: 25,870,603 (GRCm39) M56V unknown Het
Arid4a G A 12: 71,122,112 (GRCm39) S509N probably benign Het
Atp8b3 T C 10: 80,356,017 (GRCm39) R1232G probably benign Het
Axdnd1 T A 1: 156,193,259 (GRCm39) M643L probably benign Het
Bsph1 A G 7: 13,206,106 (GRCm39) Y57C probably damaging Het
Car13 G A 3: 14,706,885 (GRCm39) W6* probably null Het
Ccdc192 T C 18: 57,863,870 (GRCm39) S225P probably damaging Het
Ccng2 T C 5: 93,421,303 (GRCm39) I271T probably benign Het
Ces1f T A 8: 93,984,923 (GRCm39) D468V probably damaging Het
Chil4 A G 3: 106,117,881 (GRCm39) Y130H probably benign Het
Clns1a T A 7: 97,354,862 (GRCm39) H69Q possibly damaging Het
Cnot11 T A 1: 39,579,139 (GRCm39) S335T probably benign Het
Dcaf11 A G 14: 55,806,581 (GRCm39) S461G probably damaging Het
Dlst G A 12: 85,179,413 (GRCm39) M417I probably damaging Het
Dock4 A C 12: 40,779,937 (GRCm39) I612L probably benign Het
Endod1 A G 9: 14,268,489 (GRCm39) V332A possibly damaging Het
F830045P16Rik T C 2: 129,314,639 (GRCm39) T213A possibly damaging Het
Gm5773 A T 3: 93,681,065 (GRCm39) I246F probably damaging Het
Gml2 T A 15: 74,695,946 (GRCm39) D113E possibly damaging Het
Grik1 T C 16: 87,803,265 (GRCm39) E309G probably benign Het
Hectd1 A T 12: 51,823,355 (GRCm39) I1013K probably damaging Het
Kcmf1 T C 6: 72,835,863 (GRCm39) E22G probably damaging Het
Kdm5b T A 1: 134,528,375 (GRCm39) C361S probably damaging Het
Kif21b T C 1: 136,090,561 (GRCm39) S1150P probably damaging Het
Man2b1 G A 8: 85,821,800 (GRCm39) V701M probably damaging Het
Marchf10 T C 11: 105,281,488 (GRCm39) R266G probably damaging Het
Milr1 A G 11: 106,645,848 (GRCm39) Y130C probably damaging Het
Nampt A G 12: 32,883,042 (GRCm39) T76A possibly damaging Het
Nek10 A G 14: 14,827,059 (GRCm38) N86D possibly damaging Het
Nms T G 1: 38,983,192 (GRCm39) probably null Het
Or10w1 T A 19: 13,632,376 (GRCm39) C194* probably null Het
Parp14 A G 16: 35,678,658 (GRCm39) S437P probably damaging Het
Pif1 A G 9: 65,496,377 (GRCm39) M226V probably benign Het
Rnf169 T C 7: 99,592,204 (GRCm39) R216G probably benign Het
Rorb T C 19: 18,937,778 (GRCm39) K307R probably damaging Het
Serpinb8 T C 1: 107,534,727 (GRCm39) V266A probably damaging Het
Strip2 A G 6: 29,927,633 (GRCm39) E226G probably damaging Het
Trim23 A G 13: 104,324,618 (GRCm39) D212G possibly damaging Het
Vmn1r172 T A 7: 23,359,673 (GRCm39) V186D possibly damaging Het
Vwde A T 6: 13,186,803 (GRCm39) C895S probably damaging Het
Zswim8 C A 14: 20,767,933 (GRCm39) probably null Het
Other mutations in Scube2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Scube2 APN 7 109,407,661 (GRCm39) missense probably damaging 1.00
IGL01608:Scube2 APN 7 109,442,461 (GRCm39) missense probably benign
IGL02080:Scube2 APN 7 109,451,685 (GRCm39) missense probably damaging 1.00
PIT4445001:Scube2 UTSW 7 109,408,387 (GRCm39) missense probably benign 0.22
R0020:Scube2 UTSW 7 109,430,095 (GRCm39) splice site probably benign
R0020:Scube2 UTSW 7 109,430,095 (GRCm39) splice site probably benign
R0106:Scube2 UTSW 7 109,446,115 (GRCm39) splice site probably benign
R0230:Scube2 UTSW 7 109,423,971 (GRCm39) critical splice donor site probably null
R0255:Scube2 UTSW 7 109,424,079 (GRCm39) missense probably damaging 0.98
R0427:Scube2 UTSW 7 109,424,044 (GRCm39) missense probably benign 0.00
R0612:Scube2 UTSW 7 109,403,971 (GRCm39) splice site probably benign
R0658:Scube2 UTSW 7 109,436,327 (GRCm39) splice site probably benign
R0687:Scube2 UTSW 7 109,428,335 (GRCm39) missense possibly damaging 0.47
R1366:Scube2 UTSW 7 109,403,821 (GRCm39) missense probably damaging 1.00
R1635:Scube2 UTSW 7 109,442,421 (GRCm39) missense possibly damaging 0.90
R1797:Scube2 UTSW 7 109,430,882 (GRCm39) missense probably damaging 1.00
R1972:Scube2 UTSW 7 109,408,421 (GRCm39) missense probably benign 0.16
R2080:Scube2 UTSW 7 109,407,712 (GRCm39) missense possibly damaging 0.77
R2254:Scube2 UTSW 7 109,424,666 (GRCm39) missense possibly damaging 0.47
R2315:Scube2 UTSW 7 109,403,908 (GRCm39) missense probably damaging 1.00
R2325:Scube2 UTSW 7 109,443,161 (GRCm39) missense probably damaging 1.00
R3723:Scube2 UTSW 7 109,407,613 (GRCm39) splice site probably benign
R3887:Scube2 UTSW 7 109,442,383 (GRCm39) splice site probably benign
R3946:Scube2 UTSW 7 109,456,797 (GRCm39) missense possibly damaging 0.81
R4030:Scube2 UTSW 7 109,430,978 (GRCm39) missense probably benign 0.09
R4621:Scube2 UTSW 7 109,399,857 (GRCm39) missense possibly damaging 0.63
R4684:Scube2 UTSW 7 109,409,920 (GRCm39) missense probably damaging 0.96
R4736:Scube2 UTSW 7 109,430,412 (GRCm39) missense probably benign 0.01
R5096:Scube2 UTSW 7 109,398,451 (GRCm39) utr 3 prime probably benign
R5266:Scube2 UTSW 7 109,408,437 (GRCm39) missense probably damaging 1.00
R5579:Scube2 UTSW 7 109,409,944 (GRCm39) missense probably damaging 1.00
R5669:Scube2 UTSW 7 109,424,646 (GRCm39) missense probably benign 0.04
R5838:Scube2 UTSW 7 109,407,651 (GRCm39) missense probably damaging 1.00
R5916:Scube2 UTSW 7 109,430,931 (GRCm39) missense possibly damaging 0.77
R6056:Scube2 UTSW 7 109,432,220 (GRCm39) nonsense probably null
R6731:Scube2 UTSW 7 109,409,944 (GRCm39) missense probably damaging 1.00
R6785:Scube2 UTSW 7 109,409,824 (GRCm39) missense probably benign
R8197:Scube2 UTSW 7 109,407,684 (GRCm39) missense possibly damaging 0.53
R8250:Scube2 UTSW 7 109,463,377 (GRCm39) missense probably benign 0.20
R8273:Scube2 UTSW 7 109,408,383 (GRCm39) missense probably benign 0.00
R8427:Scube2 UTSW 7 109,399,797 (GRCm39) missense probably damaging 1.00
R8882:Scube2 UTSW 7 109,451,680 (GRCm39) missense probably damaging 1.00
R9258:Scube2 UTSW 7 109,398,515 (GRCm39) missense probably damaging 1.00
R9428:Scube2 UTSW 7 109,428,345 (GRCm39) missense probably benign 0.32
R9476:Scube2 UTSW 7 109,430,969 (GRCm39) missense probably damaging 1.00
R9510:Scube2 UTSW 7 109,430,969 (GRCm39) missense probably damaging 1.00
R9709:Scube2 UTSW 7 109,430,971 (GRCm39) missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109,442,408 (GRCm39) missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109,437,334 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTGCTCATGCAGAGAACAACC -3'
(R):5'- GGGAGAGACAGTCAGCCTTTGATG -3'

Sequencing Primer
(F):5'- CAAGGAGCCTGAGAAGTACCTC -3'
(R):5'- CAGCCTTTGATGTACTGTTGC -3'
Posted On 2013-11-18