Incidental Mutation 'R1087:Pif1'
ID85075
Institutional Source Beutler Lab
Gene Symbol Pif1
Ensembl Gene ENSMUSG00000041064
Gene NamePIF1 5'-to-3' DNA helicase
SynonymsAI449441
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1087 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location65587160-65595967 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65589095 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 226 (M226V)
Ref Sequence ENSEMBL: ENSMUSP00000117085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047099] [ENSMUST00000131483] [ENSMUST00000134538] [ENSMUST00000136205] [ENSMUST00000141046] [ENSMUST00000154970]
Predicted Effect probably benign
Transcript: ENSMUST00000047099
AA Change: M226V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049046
Gene: ENSMUSG00000041064
AA Change: M226V

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
Pfam:AAA_30 215 426 1.8e-15 PFAM
Pfam:PIF1 215 513 2.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131483
AA Change: M226V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117494
Gene: ENSMUSG00000041064
AA Change: M226V

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
Pfam:AAA_30 215 426 1.8e-15 PFAM
Pfam:PIF1 215 513 2.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134538
AA Change: M226V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122060
Gene: ENSMUSG00000041064
AA Change: M226V

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
Pfam:AAA_30 215 426 1.8e-15 PFAM
Pfam:PIF1 215 513 2.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136205
Predicted Effect probably benign
Transcript: ENSMUST00000141046
SMART Domains Protein: ENSMUSP00000120400
Gene: ENSMUSG00000041064

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152885
Predicted Effect probably benign
Transcript: ENSMUST00000154970
AA Change: M226V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117085
Gene: ENSMUSG00000041064
AA Change: M226V

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
Pfam:AAA_30 215 410 1e-14 PFAM
Pfam:PIF1 215 410 8e-59 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-dependent adenosine triphosphate (ATP)-metabolizing enzyme that functions as a 5' to 3' DNA helicase. The encoded protein can resolve G-quadruplex structures and RNA-DNA hybrids at the ends of chromosomes. It also prevents telomere elongation by inhibiting the actions of telomerase. Alternative splicing and the use of alternative start codons results in multiple isoforms that are differentially localized to either the mitochondria or the nucleus. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal and show no evidence of increased sensitivity to DNA damage, genetic instability, reproducible telomere length alteration or other cellular abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T C 18: 57,730,798 S225P probably damaging Het
Anxa11 A G 14: 25,870,179 M56V unknown Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Atp8b3 T C 10: 80,520,183 R1232G probably benign Het
Axdnd1 T A 1: 156,365,689 M643L probably benign Het
Bsph1 A G 7: 13,472,181 Y57C probably damaging Het
Car13 G A 3: 14,641,825 W6* probably null Het
Ccng2 T C 5: 93,273,444 I271T probably benign Het
Ces1f T A 8: 93,258,295 D468V probably damaging Het
Chil4 A G 3: 106,210,565 Y130H probably benign Het
Clns1a T A 7: 97,705,655 H69Q possibly damaging Het
Cnot11 T A 1: 39,540,058 S335T probably benign Het
Dcaf11 A G 14: 55,569,124 S461G probably damaging Het
Dlst G A 12: 85,132,639 M417I probably damaging Het
Dock4 A C 12: 40,729,938 I612L probably benign Het
Endod1 A G 9: 14,357,193 V332A possibly damaging Het
F830045P16Rik T C 2: 129,472,719 T213A possibly damaging Het
Gm5773 A T 3: 93,773,758 I246F probably damaging Het
Gml2 T A 15: 74,824,097 D113E possibly damaging Het
Grik1 T C 16: 88,006,377 E309G probably benign Het
Hectd1 A T 12: 51,776,572 I1013K probably damaging Het
Kcmf1 T C 6: 72,858,880 E22G probably damaging Het
Kdm5b T A 1: 134,600,637 C361S probably damaging Het
Kif21b T C 1: 136,162,823 S1150P probably damaging Het
Man2b1 G A 8: 85,095,171 V701M probably damaging Het
March10 T C 11: 105,390,662 R266G probably damaging Het
Milr1 A G 11: 106,755,022 Y130C probably damaging Het
Nampt A G 12: 32,833,043 T76A possibly damaging Het
Nek10 A G 14: 14,827,059 N86D possibly damaging Het
Nms T G 1: 38,944,111 probably null Het
Olfr1490 T A 19: 13,655,012 C194* probably null Het
Parp14 A G 16: 35,858,288 S437P probably damaging Het
Rnf169 T C 7: 99,942,997 R216G probably benign Het
Rorb T C 19: 18,960,414 K307R probably damaging Het
Scube2 T C 7: 109,831,675 D439G probably damaging Het
Serpinb8 T C 1: 107,606,997 V266A probably damaging Het
Strip2 A G 6: 29,927,634 E226G probably damaging Het
Trim23 A G 13: 104,188,110 D212G possibly damaging Het
Vmn1r172 T A 7: 23,660,248 V186D possibly damaging Het
Vwde A T 6: 13,186,804 C895S probably damaging Het
Zswim8 C A 14: 20,717,865 probably null Het
Other mutations in Pif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Pif1 APN 9 65593277 missense probably damaging 1.00
IGL01343:Pif1 APN 9 65589562 missense probably damaging 1.00
IGL01753:Pif1 APN 9 65593308 missense probably damaging 1.00
R0415:Pif1 UTSW 9 65588051 missense probably benign 0.00
R1742:Pif1 UTSW 9 65587850 missense probably benign 0.12
R1861:Pif1 UTSW 9 65589453 missense probably damaging 1.00
R3804:Pif1 UTSW 9 65588306 missense probably damaging 0.99
R3950:Pif1 UTSW 9 65591834 missense probably damaging 1.00
R4457:Pif1 UTSW 9 65587776 utr 5 prime probably benign
R4853:Pif1 UTSW 9 65593576 missense probably damaging 1.00
R5192:Pif1 UTSW 9 65588092 missense probably benign 0.02
R5196:Pif1 UTSW 9 65588092 missense probably benign 0.02
R5269:Pif1 UTSW 9 65591829 missense possibly damaging 0.82
R6703:Pif1 UTSW 9 65593263 missense probably damaging 1.00
R7451:Pif1 UTSW 9 65588348 missense probably benign 0.00
R7556:Pif1 UTSW 9 65589711 critical splice acceptor site probably null
R7938:Pif1 UTSW 9 65594791 missense probably benign 0.01
R8723:Pif1 UTSW 9 65594391 missense probably damaging 1.00
X0064:Pif1 UTSW 9 65594478 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GCCTGCTCAAAGTTCCAAGTGACG -3'
(R):5'- ACTTACCTGCAAAGGCATGAAGGG -3'

Sequencing Primer
(F):5'- CGTCAAGAGCACAGCAAAG -3'
(R):5'- GCCACAGTACCAGTAGGGG -3'
Posted On2013-11-18