Incidental Mutation 'R1087:Milr1'
ID85079
Institutional Source Beutler Lab
Gene Symbol Milr1
Ensembl Gene ENSMUSG00000040528
Gene Namemast cell immunoglobulin like receptor 1
SynonymsGm885, Allergin-1, LOC380732
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1087 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location106751226-106768794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106755022 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 130 (Y130C)
Ref Sequence ENSEMBL: ENSMUSP00000138513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068021] [ENSMUST00000086353] [ENSMUST00000106794] [ENSMUST00000147326] [ENSMUST00000182023] [ENSMUST00000182479] [ENSMUST00000182896] [ENSMUST00000182908] [ENSMUST00000183111]
Predicted Effect probably benign
Transcript: ENSMUST00000068021
SMART Domains Protein: ENSMUSP00000067111
Gene: ENSMUSG00000020717

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 32 118 3.54e-4 SMART
Pfam:Ig_3 122 198 4.2e-4 PFAM
IG_like 230 311 1.38e2 SMART
IG_like 327 382 2e-1 SMART
Blast:IG_like 405 486 3e-31 BLAST
IG 497 584 5.49e-1 SMART
transmembrane domain 592 614 N/A INTRINSIC
PDB:2KY5|A 676 718 1e-10 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000086353
AA Change: Y130C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083538
Gene: ENSMUSG00000040528
AA Change: Y130C

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
IG 58 139 3.74e-3 SMART
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106794
AA Change: Y130C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102406
Gene: ENSMUSG00000040528
AA Change: Y130C

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
IG 58 139 1.5e-5 SMART
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147326
AA Change: Y130C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138742
Gene: ENSMUSG00000040528
AA Change: Y130C

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
IG 58 139 3.74e-3 SMART
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182023
AA Change: Y130C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138286
Gene: ENSMUSG00000040528
AA Change: Y130C

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
IG 58 139 3.74e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182479
AA Change: Y27C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138386
Gene: ENSMUSG00000040528
AA Change: Y27C

DomainStartEndE-ValueType
Blast:IG 1 36 3e-19 BLAST
transmembrane domain 48 70 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182896
AA Change: Y130C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138617
Gene: ENSMUSG00000040528
AA Change: Y130C

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
IG 58 139 3.74e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182908
AA Change: Y130C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138678
Gene: ENSMUSG00000040528
AA Change: Y130C

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
IG 58 139 3.74e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183111
AA Change: Y130C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138513
Gene: ENSMUSG00000040528
AA Change: Y130C

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
IG 58 139 3.74e-3 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele have decreased mast cell degranulation and an increased susceptibility to type I hypersensitivity reaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T C 18: 57,730,798 S225P probably damaging Het
Anxa11 A G 14: 25,870,179 M56V unknown Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Atp8b3 T C 10: 80,520,183 R1232G probably benign Het
Axdnd1 T A 1: 156,365,689 M643L probably benign Het
Bsph1 A G 7: 13,472,181 Y57C probably damaging Het
Car13 G A 3: 14,641,825 W6* probably null Het
Ccng2 T C 5: 93,273,444 I271T probably benign Het
Ces1f T A 8: 93,258,295 D468V probably damaging Het
Chil4 A G 3: 106,210,565 Y130H probably benign Het
Clns1a T A 7: 97,705,655 H69Q possibly damaging Het
Cnot11 T A 1: 39,540,058 S335T probably benign Het
Dcaf11 A G 14: 55,569,124 S461G probably damaging Het
Dlst G A 12: 85,132,639 M417I probably damaging Het
Dock4 A C 12: 40,729,938 I612L probably benign Het
Endod1 A G 9: 14,357,193 V332A possibly damaging Het
F830045P16Rik T C 2: 129,472,719 T213A possibly damaging Het
Gm5773 A T 3: 93,773,758 I246F probably damaging Het
Gml2 T A 15: 74,824,097 D113E possibly damaging Het
Grik1 T C 16: 88,006,377 E309G probably benign Het
Hectd1 A T 12: 51,776,572 I1013K probably damaging Het
Kcmf1 T C 6: 72,858,880 E22G probably damaging Het
Kdm5b T A 1: 134,600,637 C361S probably damaging Het
Kif21b T C 1: 136,162,823 S1150P probably damaging Het
Man2b1 G A 8: 85,095,171 V701M probably damaging Het
March10 T C 11: 105,390,662 R266G probably damaging Het
Nampt A G 12: 32,833,043 T76A possibly damaging Het
Nek10 A G 14: 14,827,059 N86D possibly damaging Het
Nms T G 1: 38,944,111 probably null Het
Olfr1490 T A 19: 13,655,012 C194* probably null Het
Parp14 A G 16: 35,858,288 S437P probably damaging Het
Pif1 A G 9: 65,589,095 M226V probably benign Het
Rnf169 T C 7: 99,942,997 R216G probably benign Het
Rorb T C 19: 18,960,414 K307R probably damaging Het
Scube2 T C 7: 109,831,675 D439G probably damaging Het
Serpinb8 T C 1: 107,606,997 V266A probably damaging Het
Strip2 A G 6: 29,927,634 E226G probably damaging Het
Trim23 A G 13: 104,188,110 D212G possibly damaging Het
Vmn1r172 T A 7: 23,660,248 V186D possibly damaging Het
Vwde A T 6: 13,186,804 C895S probably damaging Het
Zswim8 C A 14: 20,717,865 probably null Het
Other mutations in Milr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Milr1 APN 11 106765245 missense possibly damaging 0.90
IGL02396:Milr1 APN 11 106765239 nonsense probably null
IGL02525:Milr1 APN 11 106765275 missense probably benign 0.01
IGL02620:Milr1 APN 11 106754918 missense probably damaging 0.96
R0010:Milr1 UTSW 11 106767003 makesense probably null
R0240:Milr1 UTSW 11 106754896 nonsense probably null
R0240:Milr1 UTSW 11 106754896 nonsense probably null
R4349:Milr1 UTSW 11 106763882 missense possibly damaging 0.91
R5023:Milr1 UTSW 11 106766965 missense possibly damaging 0.90
R5057:Milr1 UTSW 11 106766965 missense possibly damaging 0.90
R5169:Milr1 UTSW 11 106754928 nonsense probably null
R5181:Milr1 UTSW 11 106754980 missense probably damaging 1.00
R6649:Milr1 UTSW 11 106757711 missense probably benign 0.01
R6868:Milr1 UTSW 11 106763921 missense probably damaging 1.00
R7008:Milr1 UTSW 11 106751314 missense probably damaging 0.99
R7916:Milr1 UTSW 11 106763862 missense possibly damaging 0.50
R8265:Milr1 UTSW 11 106763885 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGGTTTTCACGAAGCCTTCTGTGTC -3'
(R):5'- GATGAGCCATGTTCTTCCCAGACTC -3'

Sequencing Primer
(F):5'- CTGAACTCAAGTATGAACGTGGTC -3'
(R):5'- TTCCCAGACTCTTGACAGAATG -3'
Posted On2013-11-18