Incidental Mutation 'R1087:Nampt'
ID85080
Institutional Source Beutler Lab
Gene Symbol Nampt
Ensembl Gene ENSMUSG00000020572
Gene Namenicotinamide phosphoribosyltransferase
SynonymsPbef1, 1110035O14Rik, Visfatin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1087 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location32819545-32853349 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32833043 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 76 (T76A)
Ref Sequence ENSEMBL: ENSMUSP00000020886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020886] [ENSMUST00000220200]
PDB Structure Crystal Structure of Murine NMPRTase [X-RAY DIFFRACTION]
Crystal Structure of Mouse Nicotinamide Phosphoribosyltransferase/Visfatin/Pre-B Cell Colony Enhancing Factor 1 [X-RAY DIFFRACTION]
Crystal Structure of Mouse Nicotinamide Phosphoribosyltransferase/Visfatin/Pre-B Cell Colony Enhancing Factor in Complex with Nicotinamide Mononuleotide [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020886
AA Change: T76A

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020886
Gene: ENSMUSG00000020572
AA Change: T76A

DomainStartEndE-ValueType
Pfam:NAPRTase 188 466 1.6e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218491
Predicted Effect probably benign
Transcript: ENSMUST00000220200
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that catalyzes the condensation of nicotinamide with 5-phosphoribosyl-1-pyrophosphate to yield nicotinamide mononucleotide, one step in the biosynthesis of nicotinamide adenine dinucleotide. The protein belongs to the nicotinic acid phosphoribosyltransferase (NAPRTase) family and is thought to be involved in many important biological processes, including metabolism, stress response and aging. This gene has a pseudogene on chromosome 10. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality prior to E10.5. Mice heterozygous for a null allele exhibit increased fasted glucose in male mice and impaired glucose tolerance and decresed glucose-stimulated insulin secretion in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T C 18: 57,730,798 S225P probably damaging Het
Anxa11 A G 14: 25,870,179 M56V unknown Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Atp8b3 T C 10: 80,520,183 R1232G probably benign Het
Axdnd1 T A 1: 156,365,689 M643L probably benign Het
Bsph1 A G 7: 13,472,181 Y57C probably damaging Het
Car13 G A 3: 14,641,825 W6* probably null Het
Ccng2 T C 5: 93,273,444 I271T probably benign Het
Ces1f T A 8: 93,258,295 D468V probably damaging Het
Chil4 A G 3: 106,210,565 Y130H probably benign Het
Clns1a T A 7: 97,705,655 H69Q possibly damaging Het
Cnot11 T A 1: 39,540,058 S335T probably benign Het
Dcaf11 A G 14: 55,569,124 S461G probably damaging Het
Dlst G A 12: 85,132,639 M417I probably damaging Het
Dock4 A C 12: 40,729,938 I612L probably benign Het
Endod1 A G 9: 14,357,193 V332A possibly damaging Het
F830045P16Rik T C 2: 129,472,719 T213A possibly damaging Het
Gm5773 A T 3: 93,773,758 I246F probably damaging Het
Gml2 T A 15: 74,824,097 D113E possibly damaging Het
Grik1 T C 16: 88,006,377 E309G probably benign Het
Hectd1 A T 12: 51,776,572 I1013K probably damaging Het
Kcmf1 T C 6: 72,858,880 E22G probably damaging Het
Kdm5b T A 1: 134,600,637 C361S probably damaging Het
Kif21b T C 1: 136,162,823 S1150P probably damaging Het
Man2b1 G A 8: 85,095,171 V701M probably damaging Het
March10 T C 11: 105,390,662 R266G probably damaging Het
Milr1 A G 11: 106,755,022 Y130C probably damaging Het
Nek10 A G 14: 14,827,059 N86D possibly damaging Het
Nms T G 1: 38,944,111 probably null Het
Olfr1490 T A 19: 13,655,012 C194* probably null Het
Parp14 A G 16: 35,858,288 S437P probably damaging Het
Pif1 A G 9: 65,589,095 M226V probably benign Het
Rnf169 T C 7: 99,942,997 R216G probably benign Het
Rorb T C 19: 18,960,414 K307R probably damaging Het
Scube2 T C 7: 109,831,675 D439G probably damaging Het
Serpinb8 T C 1: 107,606,997 V266A probably damaging Het
Strip2 A G 6: 29,927,634 E226G probably damaging Het
Trim23 A G 13: 104,188,110 D212G possibly damaging Het
Vmn1r172 T A 7: 23,660,248 V186D possibly damaging Het
Vwde A T 6: 13,186,804 C895S probably damaging Het
Zswim8 C A 14: 20,717,865 probably null Het
Other mutations in Nampt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02437:Nampt APN 12 32830216 missense probably damaging 1.00
IGL02512:Nampt APN 12 32830269 missense possibly damaging 0.72
IGL03095:Nampt APN 12 32842686 missense possibly damaging 0.85
Nacht UTSW 12 32833038 missense probably damaging 1.00
R0020:Nampt UTSW 12 32841013 missense probably damaging 0.97
R0417:Nampt UTSW 12 32833101 missense probably benign 0.01
R1781:Nampt UTSW 12 32833038 missense probably damaging 1.00
R2137:Nampt UTSW 12 32830310 missense probably benign
R2138:Nampt UTSW 12 32838422 missense possibly damaging 0.46
R3699:Nampt UTSW 12 32848759 splice site probably benign
R3970:Nampt UTSW 12 32833096 missense probably benign 0.02
R4434:Nampt UTSW 12 32838363 missense probably damaging 1.00
R4785:Nampt UTSW 12 32848714 missense possibly damaging 0.95
R5046:Nampt UTSW 12 32833038 missense probably damaging 1.00
R5055:Nampt UTSW 12 32833121 missense possibly damaging 0.94
R5427:Nampt UTSW 12 32834915 missense probably benign 0.00
R6063:Nampt UTSW 12 32848659 missense probably damaging 1.00
R6136:Nampt UTSW 12 32830302 missense probably benign 0.24
R6995:Nampt UTSW 12 32848743 missense probably benign 0.24
R7569:Nampt UTSW 12 32850434 missense probably benign
R8801:Nampt UTSW 12 32838374 missense possibly damaging 0.62
R8802:Nampt UTSW 12 32850436 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CCAGAAGTACAGGCTCCTTTTCTGAAC -3'
(R):5'- TTCTGAAACTGCGAAGTAACCATACCC -3'

Sequencing Primer
(F):5'- GAACCTGCTCCTGACCTG -3'
(R):5'- CTGGTTAGTGATTCATACTACAGGAG -3'
Posted On2013-11-18