Incidental Mutation 'R1087:Dlst'
ID85084
Institutional Source Beutler Lab
Gene Symbol Dlst
Ensembl Gene ENSMUSG00000004789
Gene Namedihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R1087 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location85110833-85134845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85132639 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 417 (M417I)
Ref Sequence ENSEMBL: ENSMUSP00000152664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019379] [ENSMUST00000053811] [ENSMUST00000221357] [ENSMUST00000221972] [ENSMUST00000223332]
Predicted Effect probably benign
Transcript: ENSMUST00000019379
SMART Domains Protein: ENSMUSP00000019379
Gene: ENSMUSG00000019235

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
MIT 46 123 8.99e-25 SMART
low complexity region 155 166 N/A INTRINSIC
Pfam:Pkinase_Tyr 178 519 1.9e-12 PFAM
Pfam:Pkinase 367 534 1.1e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000053811
AA Change: M417I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060346
Gene: ENSMUSG00000004789
AA Change: M417I

DomainStartEndE-ValueType
Pfam:Biotin_lipoyl 72 144 1.7e-22 PFAM
low complexity region 149 180 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
low complexity region 205 217 N/A INTRINSIC
Pfam:2-oxoacid_dh 221 452 2.3e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220633
Predicted Effect probably damaging
Transcript: ENSMUST00000221357
AA Change: M417I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000221972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222472
Predicted Effect probably benign
Transcript: ENSMUST00000223332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223413
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223438
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein that belongs to the 2-oxoacid dehydrogenase family. This protein is one of the three components (the E2 component) of the 2-oxoglutarate dehydrogenase complex that catalyzes the overall conversion of 2-oxoglutarate to succinyl-CoA and CO(2). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice heterozygous for a gene trap allele exhibit an accelerates amyloid pathology and memory deficit in a transgenic mouse model of amyloid deposition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T C 18: 57,730,798 S225P probably damaging Het
Anxa11 A G 14: 25,870,179 M56V unknown Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Atp8b3 T C 10: 80,520,183 R1232G probably benign Het
Axdnd1 T A 1: 156,365,689 M643L probably benign Het
Bsph1 A G 7: 13,472,181 Y57C probably damaging Het
Car13 G A 3: 14,641,825 W6* probably null Het
Ccng2 T C 5: 93,273,444 I271T probably benign Het
Ces1f T A 8: 93,258,295 D468V probably damaging Het
Chil4 A G 3: 106,210,565 Y130H probably benign Het
Clns1a T A 7: 97,705,655 H69Q possibly damaging Het
Cnot11 T A 1: 39,540,058 S335T probably benign Het
Dcaf11 A G 14: 55,569,124 S461G probably damaging Het
Dock4 A C 12: 40,729,938 I612L probably benign Het
Endod1 A G 9: 14,357,193 V332A possibly damaging Het
F830045P16Rik T C 2: 129,472,719 T213A possibly damaging Het
Gm5773 A T 3: 93,773,758 I246F probably damaging Het
Gml2 T A 15: 74,824,097 D113E possibly damaging Het
Grik1 T C 16: 88,006,377 E309G probably benign Het
Hectd1 A T 12: 51,776,572 I1013K probably damaging Het
Kcmf1 T C 6: 72,858,880 E22G probably damaging Het
Kdm5b T A 1: 134,600,637 C361S probably damaging Het
Kif21b T C 1: 136,162,823 S1150P probably damaging Het
Man2b1 G A 8: 85,095,171 V701M probably damaging Het
March10 T C 11: 105,390,662 R266G probably damaging Het
Milr1 A G 11: 106,755,022 Y130C probably damaging Het
Nampt A G 12: 32,833,043 T76A possibly damaging Het
Nek10 A G 14: 14,827,059 N86D possibly damaging Het
Nms T G 1: 38,944,111 probably null Het
Olfr1490 T A 19: 13,655,012 C194* probably null Het
Parp14 A G 16: 35,858,288 S437P probably damaging Het
Pif1 A G 9: 65,589,095 M226V probably benign Het
Rnf169 T C 7: 99,942,997 R216G probably benign Het
Rorb T C 19: 18,960,414 K307R probably damaging Het
Scube2 T C 7: 109,831,675 D439G probably damaging Het
Serpinb8 T C 1: 107,606,997 V266A probably damaging Het
Strip2 A G 6: 29,927,634 E226G probably damaging Het
Trim23 A G 13: 104,188,110 D212G possibly damaging Het
Vmn1r172 T A 7: 23,660,248 V186D possibly damaging Het
Vwde A T 6: 13,186,804 C895S probably damaging Het
Zswim8 C A 14: 20,717,865 probably null Het
Other mutations in Dlst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02120:Dlst APN 12 85118568 missense probably benign 0.01
IGL02150:Dlst APN 12 85131033 missense possibly damaging 0.91
IGL02223:Dlst APN 12 85130918 missense probably benign 0.13
I1329:Dlst UTSW 12 85123841 missense probably damaging 1.00
R0331:Dlst UTSW 12 85118812 missense probably damaging 1.00
R1218:Dlst UTSW 12 85123864 missense probably damaging 1.00
R3901:Dlst UTSW 12 85132691 missense possibly damaging 0.55
R4705:Dlst UTSW 12 85118842 splice site probably null
R5457:Dlst UTSW 12 85122140 critical splice donor site probably null
R6039:Dlst UTSW 12 85118890 splice site probably null
R6039:Dlst UTSW 12 85118890 splice site probably null
R6422:Dlst UTSW 12 85130885 splice site probably null
R7078:Dlst UTSW 12 85110931 missense probably benign 0.03
R7366:Dlst UTSW 12 85128315 missense probably benign
R7900:Dlst UTSW 12 85130518 missense probably benign 0.00
Z1177:Dlst UTSW 12 85110893 utr 5 prime probably benign
Predicted Primers PCR Primer
(F):5'- TGCAGAACAAACCTCTGTGGGTAAC -3'
(R):5'- GCCAATAGTATGTGCCTGCCTGTC -3'

Sequencing Primer
(F):5'- CTGTAGAGCACAGTGTAGCTTAC -3'
(R):5'- CATCAGGCTAACCTGGGATTG -3'
Posted On2013-11-18