Incidental Mutation 'R1087:Trim23'
ID85085
Institutional Source Beutler Lab
Gene Symbol Trim23
Ensembl Gene ENSMUSG00000021712
Gene Nametripartite motif-containing 23
Synonyms6330516O20Rik, Arfd1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R1087 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location104178797-104203372 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104188110 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 212 (D212G)
Ref Sequence ENSEMBL: ENSMUSP00000069371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022225] [ENSMUST00000069174] [ENSMUST00000069187]
Predicted Effect probably benign
Transcript: ENSMUST00000022225
AA Change: D232G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000022225
Gene: ENSMUSG00000021712
AA Change: D232G

DomainStartEndE-ValueType
RING 31 75 3.07e-5 SMART
BBOX 122 168 3.07e-1 SMART
BBOX 173 219 1.32e-4 SMART
BBC 226 370 2.89e-41 SMART
ARF 387 569 1.15e-78 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000069174
AA Change: D212G

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000069371
Gene: ENSMUSG00000021712
AA Change: D212G

DomainStartEndE-ValueType
RING 11 55 3.07e-5 SMART
BBOX 102 148 3.07e-1 SMART
BBOX 153 199 1.32e-4 SMART
BBC 206 350 2.89e-41 SMART
ARF 367 549 1.15e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069187
SMART Domains Protein: ENSMUSP00000070767
Gene: ENSMUSG00000021712

DomainStartEndE-ValueType
RING 31 75 3.07e-5 SMART
BBOX 122 168 3.07e-1 SMART
BBOX 173 219 5.95e-3 SMART
BBC 182 309 8.07e-22 SMART
ARF 326 508 1.15e-78 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein is also a member of the ADP ribosylation factor family of guanine nucleotide-binding family of proteins. Its carboxy terminus contains an ADP-ribosylation factor domain and a guanine nucleotide binding site, while the amino terminus contains a GTPase activating protein domain which acts on the guanine nucleotide binding site. The protein localizes to lysosomes and the Golgi apparatus. It plays a role in the formation of intracellular transport vesicles, their movement from one compartment to another, and phopholipase D activation. Three alternatively spliced transcript variants for this gene have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit mild myopathy with sarcotubular myopathy, decreased fertility, and decreased axon diameter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T C 18: 57,730,798 S225P probably damaging Het
Anxa11 A G 14: 25,870,179 M56V unknown Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Atp8b3 T C 10: 80,520,183 R1232G probably benign Het
Axdnd1 T A 1: 156,365,689 M643L probably benign Het
Bsph1 A G 7: 13,472,181 Y57C probably damaging Het
Car13 G A 3: 14,641,825 W6* probably null Het
Ccng2 T C 5: 93,273,444 I271T probably benign Het
Ces1f T A 8: 93,258,295 D468V probably damaging Het
Chil4 A G 3: 106,210,565 Y130H probably benign Het
Clns1a T A 7: 97,705,655 H69Q possibly damaging Het
Cnot11 T A 1: 39,540,058 S335T probably benign Het
Dcaf11 A G 14: 55,569,124 S461G probably damaging Het
Dlst G A 12: 85,132,639 M417I probably damaging Het
Dock4 A C 12: 40,729,938 I612L probably benign Het
Endod1 A G 9: 14,357,193 V332A possibly damaging Het
F830045P16Rik T C 2: 129,472,719 T213A possibly damaging Het
Gm5773 A T 3: 93,773,758 I246F probably damaging Het
Gml2 T A 15: 74,824,097 D113E possibly damaging Het
Grik1 T C 16: 88,006,377 E309G probably benign Het
Hectd1 A T 12: 51,776,572 I1013K probably damaging Het
Kcmf1 T C 6: 72,858,880 E22G probably damaging Het
Kdm5b T A 1: 134,600,637 C361S probably damaging Het
Kif21b T C 1: 136,162,823 S1150P probably damaging Het
Man2b1 G A 8: 85,095,171 V701M probably damaging Het
March10 T C 11: 105,390,662 R266G probably damaging Het
Milr1 A G 11: 106,755,022 Y130C probably damaging Het
Nampt A G 12: 32,833,043 T76A possibly damaging Het
Nek10 A G 14: 14,827,059 N86D possibly damaging Het
Nms T G 1: 38,944,111 probably null Het
Olfr1490 T A 19: 13,655,012 C194* probably null Het
Parp14 A G 16: 35,858,288 S437P probably damaging Het
Pif1 A G 9: 65,589,095 M226V probably benign Het
Rnf169 T C 7: 99,942,997 R216G probably benign Het
Rorb T C 19: 18,960,414 K307R probably damaging Het
Scube2 T C 7: 109,831,675 D439G probably damaging Het
Serpinb8 T C 1: 107,606,997 V266A probably damaging Het
Strip2 A G 6: 29,927,634 E226G probably damaging Het
Vmn1r172 T A 7: 23,660,248 V186D possibly damaging Het
Vwde A T 6: 13,186,804 C895S probably damaging Het
Zswim8 C A 14: 20,717,865 probably null Het
Other mutations in Trim23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02092:Trim23 APN 13 104187612 missense probably benign 0.30
R0462:Trim23 UTSW 13 104198033 missense probably damaging 1.00
R0638:Trim23 UTSW 13 104201309 missense probably benign 0.00
R0980:Trim23 UTSW 13 104188127 missense probably damaging 1.00
R1764:Trim23 UTSW 13 104198618 missense probably damaging 1.00
R2441:Trim23 UTSW 13 104192075 missense probably damaging 1.00
R4006:Trim23 UTSW 13 104187623 missense probably benign 0.00
R4010:Trim23 UTSW 13 104181018 unclassified probably benign
R5162:Trim23 UTSW 13 104181174 missense probably damaging 0.98
R5383:Trim23 UTSW 13 104198697 missense probably damaging 1.00
R5389:Trim23 UTSW 13 104192033 missense probably damaging 0.96
R5520:Trim23 UTSW 13 104187527 missense probably damaging 1.00
R5539:Trim23 UTSW 13 104198033 missense probably damaging 1.00
R5557:Trim23 UTSW 13 104187509 missense probably damaging 1.00
R7079:Trim23 UTSW 13 104187293 splice site probably null
R7249:Trim23 UTSW 13 104188155 missense probably damaging 0.99
R7290:Trim23 UTSW 13 104187433 missense probably damaging 1.00
R7608:Trim23 UTSW 13 104192033 missense probably benign 0.36
R8495:Trim23 UTSW 13 104201309 missense probably benign 0.00
R8851:Trim23 UTSW 13 104198065 missense possibly damaging 0.63
Z1187:Trim23 UTSW 13 104178887 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACGAAGCCACTGTGACTGATGTTC -3'
(R):5'- CTCCAGCATGACTAATGGGTTCTGC -3'

Sequencing Primer
(F):5'- ATAGCATTCAGTACTGG -3'
(R):5'- cgtggtctttaactcttcaatttttc -3'
Posted On2013-11-18