Incidental Mutation 'R1087:Nek10'
ID85086
Institutional Source Beutler Lab
Gene Symbol Nek10
Ensembl Gene ENSMUSG00000042567
Gene NameNIMA (never in mitosis gene a)- related kinase 10
SynonymsLOC238944
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1087 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location14803415-15012059 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14827059 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 86 (N86D)
Ref Sequence ENSEMBL: ENSMUSP00000153142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112630] [ENSMUST00000112631] [ENSMUST00000224491]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112630
AA Change: N86D

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108249
Gene: ENSMUSG00000042567
AA Change: N86D

DomainStartEndE-ValueType
ARM 197 238 8.23e1 SMART
ARM 278 320 5.18e0 SMART
low complexity region 387 400 N/A INTRINSIC
ARM 401 448 7.09e1 SMART
S_TKc 519 791 2.36e-75 SMART
low complexity region 799 811 N/A INTRINSIC
low complexity region 839 863 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112631
AA Change: N86D

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108250
Gene: ENSMUSG00000042567
AA Change: N86D

DomainStartEndE-ValueType
ARM 197 238 8.23e1 SMART
ARM 278 320 5.18e0 SMART
low complexity region 387 400 N/A INTRINSIC
ARM 401 448 7.09e1 SMART
S_TKc 519 791 2.36e-75 SMART
low complexity region 799 811 N/A INTRINSIC
low complexity region 839 863 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224491
AA Change: N86D

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T C 18: 57,730,798 S225P probably damaging Het
Anxa11 A G 14: 25,870,179 M56V unknown Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Atp8b3 T C 10: 80,520,183 R1232G probably benign Het
Axdnd1 T A 1: 156,365,689 M643L probably benign Het
Bsph1 A G 7: 13,472,181 Y57C probably damaging Het
Car13 G A 3: 14,641,825 W6* probably null Het
Ccng2 T C 5: 93,273,444 I271T probably benign Het
Ces1f T A 8: 93,258,295 D468V probably damaging Het
Chil4 A G 3: 106,210,565 Y130H probably benign Het
Clns1a T A 7: 97,705,655 H69Q possibly damaging Het
Cnot11 T A 1: 39,540,058 S335T probably benign Het
Dcaf11 A G 14: 55,569,124 S461G probably damaging Het
Dlst G A 12: 85,132,639 M417I probably damaging Het
Dock4 A C 12: 40,729,938 I612L probably benign Het
Endod1 A G 9: 14,357,193 V332A possibly damaging Het
F830045P16Rik T C 2: 129,472,719 T213A possibly damaging Het
Gm5773 A T 3: 93,773,758 I246F probably damaging Het
Gml2 T A 15: 74,824,097 D113E possibly damaging Het
Grik1 T C 16: 88,006,377 E309G probably benign Het
Hectd1 A T 12: 51,776,572 I1013K probably damaging Het
Kcmf1 T C 6: 72,858,880 E22G probably damaging Het
Kdm5b T A 1: 134,600,637 C361S probably damaging Het
Kif21b T C 1: 136,162,823 S1150P probably damaging Het
Man2b1 G A 8: 85,095,171 V701M probably damaging Het
March10 T C 11: 105,390,662 R266G probably damaging Het
Milr1 A G 11: 106,755,022 Y130C probably damaging Het
Nampt A G 12: 32,833,043 T76A possibly damaging Het
Nms T G 1: 38,944,111 probably null Het
Olfr1490 T A 19: 13,655,012 C194* probably null Het
Parp14 A G 16: 35,858,288 S437P probably damaging Het
Pif1 A G 9: 65,589,095 M226V probably benign Het
Rnf169 T C 7: 99,942,997 R216G probably benign Het
Rorb T C 19: 18,960,414 K307R probably damaging Het
Scube2 T C 7: 109,831,675 D439G probably damaging Het
Serpinb8 T C 1: 107,606,997 V266A probably damaging Het
Strip2 A G 6: 29,927,634 E226G probably damaging Het
Trim23 A G 13: 104,188,110 D212G possibly damaging Het
Vmn1r172 T A 7: 23,660,248 V186D possibly damaging Het
Vwde A T 6: 13,186,804 C895S probably damaging Het
Zswim8 C A 14: 20,717,865 probably null Het
Other mutations in Nek10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Nek10 APN 14 14850957 missense probably damaging 0.99
IGL02067:Nek10 APN 14 14861639 missense probably benign 0.12
IGL02361:Nek10 APN 14 14843856 missense probably damaging 1.00
IGL02687:Nek10 APN 14 14840570 missense probably damaging 1.00
IGL02929:Nek10 APN 14 14821119 missense possibly damaging 0.82
IGL03229:Nek10 APN 14 14986686 missense probably benign 0.10
P0041:Nek10 UTSW 14 14861603 missense probably benign 0.01
R0007:Nek10 UTSW 14 14840574 missense probably benign 0.10
R0007:Nek10 UTSW 14 14840574 missense probably benign 0.10
R0142:Nek10 UTSW 14 14861560 missense possibly damaging 0.96
R0433:Nek10 UTSW 14 14860927 missense probably benign 0.32
R0633:Nek10 UTSW 14 14857782 critical splice acceptor site probably null
R1184:Nek10 UTSW 14 14931325 splice site probably benign
R1250:Nek10 UTSW 14 14853887 missense probably damaging 1.00
R1371:Nek10 UTSW 14 14850983 missense probably damaging 0.98
R1506:Nek10 UTSW 14 14999078 splice site probably benign
R1829:Nek10 UTSW 14 14863454 critical splice acceptor site probably null
R1831:Nek10 UTSW 14 14842789 missense probably benign
R1833:Nek10 UTSW 14 14842789 missense probably benign
R1990:Nek10 UTSW 14 14860764 missense probably benign
R1997:Nek10 UTSW 14 14827003 missense probably benign 0.09
R2011:Nek10 UTSW 14 14885122 missense probably damaging 1.00
R2158:Nek10 UTSW 14 14885047 splice site probably null
R2288:Nek10 UTSW 14 14853956 nonsense probably null
R2568:Nek10 UTSW 14 14999112 missense possibly damaging 0.89
R2907:Nek10 UTSW 14 14980613 missense possibly damaging 0.81
R2965:Nek10 UTSW 14 14836202 missense probably damaging 1.00
R3922:Nek10 UTSW 14 14861585 missense possibly damaging 0.88
R4032:Nek10 UTSW 14 14853877 splice site probably null
R4700:Nek10 UTSW 14 14842841 missense possibly damaging 0.69
R4742:Nek10 UTSW 14 14861624 missense probably null 0.03
R4785:Nek10 UTSW 14 14855714 missense probably benign
R4890:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4891:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4920:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4924:Nek10 UTSW 14 14846594 splice site probably null
R4928:Nek10 UTSW 14 14930577 missense probably damaging 1.00
R4948:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4952:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4953:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R5092:Nek10 UTSW 14 14820851 missense possibly damaging 0.81
R5097:Nek10 UTSW 14 14857851 missense probably benign 0.00
R5593:Nek10 UTSW 14 14980544 nonsense probably null
R5696:Nek10 UTSW 14 14860736 splice site probably null
R5813:Nek10 UTSW 14 14986704 missense probably benign 0.01
R5829:Nek10 UTSW 14 14865404 missense probably damaging 1.00
R5872:Nek10 UTSW 14 14850896 missense probably benign 0.06
R5939:Nek10 UTSW 14 14931290 missense possibly damaging 0.58
R6025:Nek10 UTSW 14 14865633 missense probably benign 0.41
R6235:Nek10 UTSW 14 14821113 nonsense probably null
R6539:Nek10 UTSW 14 14860789 missense possibly damaging 0.94
R6542:Nek10 UTSW 14 14999108 missense probably benign 0.44
R6561:Nek10 UTSW 14 14828448 missense possibly damaging 0.48
R6659:Nek10 UTSW 14 14861684 missense probably benign 0.29
R7039:Nek10 UTSW 14 14826946 missense possibly damaging 0.63
R7039:Nek10 UTSW 14 14986700 missense probably damaging 0.99
R7102:Nek10 UTSW 14 14828517 missense probably damaging 1.00
R7185:Nek10 UTSW 14 14846621 missense probably benign 0.03
R7198:Nek10 UTSW 14 14850947 missense probably damaging 0.99
R7202:Nek10 UTSW 14 14836171 missense probably benign 0.01
R7251:Nek10 UTSW 14 14853965 missense probably benign
R7345:Nek10 UTSW 14 14955503 missense probably benign
R7590:Nek10 UTSW 14 15006693 makesense probably null
R7593:Nek10 UTSW 14 14826955 missense probably benign 0.04
R7616:Nek10 UTSW 14 14937759 missense probably benign 0.27
R7635:Nek10 UTSW 14 14850932 missense probably benign 0.01
R7817:Nek10 UTSW 14 15001017 missense probably benign 0.00
R7826:Nek10 UTSW 14 14860846 splice site probably null
R7986:Nek10 UTSW 14 15001020 missense probably benign 0.17
R8765:Nek10 UTSW 14 14999104 missense probably damaging 0.97
R8856:Nek10 UTSW 14 14937610 missense probably damaging 0.96
Z1177:Nek10 UTSW 14 14853948 missense probably benign 0.00
Z1177:Nek10 UTSW 14 15001157 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAAAACCCTGATTCCATTAGCCCC -3'
(R):5'- AGCCTTCATGTCAGCAAGATGTCC -3'

Sequencing Primer
(F):5'- GACTTGTTTTATCACTGAATGAACC -3'
(R):5'- TGTCAGCAAGATGTCCTGAACTC -3'
Posted On2013-11-18