Incidental Mutation 'R1087:Gml2'
ID85091
Institutional Source Beutler Lab
Gene Symbol Gml2
Ensembl Gene ENSMUSG00000068600
Gene Nameglycosylphosphatidylinositol anchored molecule like 2
SynonymsHemt1, hematopoietic cell-specific transcript, HemT, 1700057K19Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R1087 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location74819071-74834871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74824097 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 113 (D113E)
Ref Sequence ENSEMBL: ENSMUSP00000094130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096399] [ENSMUST00000188180]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096399
AA Change: D113E

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000094130
Gene: ENSMUSG00000068600
AA Change: D113E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LU 47 141 2.06e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186752
Predicted Effect probably benign
Transcript: ENSMUST00000188180
SMART Domains Protein: ENSMUSP00000141185
Gene: ENSMUSG00000068600

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:LU 47 80 2e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188458
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T C 18: 57,730,798 S225P probably damaging Het
Anxa11 A G 14: 25,870,179 M56V unknown Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Atp8b3 T C 10: 80,520,183 R1232G probably benign Het
Axdnd1 T A 1: 156,365,689 M643L probably benign Het
Bsph1 A G 7: 13,472,181 Y57C probably damaging Het
Car13 G A 3: 14,641,825 W6* probably null Het
Ccng2 T C 5: 93,273,444 I271T probably benign Het
Ces1f T A 8: 93,258,295 D468V probably damaging Het
Chil4 A G 3: 106,210,565 Y130H probably benign Het
Clns1a T A 7: 97,705,655 H69Q possibly damaging Het
Cnot11 T A 1: 39,540,058 S335T probably benign Het
Dcaf11 A G 14: 55,569,124 S461G probably damaging Het
Dlst G A 12: 85,132,639 M417I probably damaging Het
Dock4 A C 12: 40,729,938 I612L probably benign Het
Endod1 A G 9: 14,357,193 V332A possibly damaging Het
F830045P16Rik T C 2: 129,472,719 T213A possibly damaging Het
Gm5773 A T 3: 93,773,758 I246F probably damaging Het
Grik1 T C 16: 88,006,377 E309G probably benign Het
Hectd1 A T 12: 51,776,572 I1013K probably damaging Het
Kcmf1 T C 6: 72,858,880 E22G probably damaging Het
Kdm5b T A 1: 134,600,637 C361S probably damaging Het
Kif21b T C 1: 136,162,823 S1150P probably damaging Het
Man2b1 G A 8: 85,095,171 V701M probably damaging Het
March10 T C 11: 105,390,662 R266G probably damaging Het
Milr1 A G 11: 106,755,022 Y130C probably damaging Het
Nampt A G 12: 32,833,043 T76A possibly damaging Het
Nek10 A G 14: 14,827,059 N86D possibly damaging Het
Nms T G 1: 38,944,111 probably null Het
Olfr1490 T A 19: 13,655,012 C194* probably null Het
Parp14 A G 16: 35,858,288 S437P probably damaging Het
Pif1 A G 9: 65,589,095 M226V probably benign Het
Rnf169 T C 7: 99,942,997 R216G probably benign Het
Rorb T C 19: 18,960,414 K307R probably damaging Het
Scube2 T C 7: 109,831,675 D439G probably damaging Het
Serpinb8 T C 1: 107,606,997 V266A probably damaging Het
Strip2 A G 6: 29,927,634 E226G probably damaging Het
Trim23 A G 13: 104,188,110 D212G possibly damaging Het
Vmn1r172 T A 7: 23,660,248 V186D possibly damaging Het
Vwde A T 6: 13,186,804 C895S probably damaging Het
Zswim8 C A 14: 20,717,865 probably null Het
Other mutations in Gml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01649:Gml2 APN 15 74824221 nonsense probably null
R0031:Gml2 UTSW 15 74824276 missense probably benign 0.12
R0608:Gml2 UTSW 15 74821386 critical splice donor site probably null
R1130:Gml2 UTSW 15 74821346 missense probably damaging 0.99
R1503:Gml2 UTSW 15 74821352 nonsense probably null
R4408:Gml2 UTSW 15 74824339 intron probably benign
R6802:Gml2 UTSW 15 74824246 missense probably damaging 1.00
R7351:Gml2 UTSW 15 74821376 missense possibly damaging 0.57
R7833:Gml2 UTSW 15 74821368 nonsense probably null
R7910:Gml2 UTSW 15 74820530 critical splice acceptor site probably null
R8513:Gml2 UTSW 15 74824155 missense probably damaging 1.00
R8695:Gml2 UTSW 15 74824240 missense probably benign 0.05
X0066:Gml2 UTSW 15 74824050 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCAGTTGGGCCATCTTGGTTAC -3'
(R):5'- TCAGGTCAGTATGATGCTGGAGAGG -3'

Sequencing Primer
(F):5'- GTCAGGCATTCTTGACAGTATC -3'
(R):5'- TCAGTATGATGCTGGAGAGGATTAAG -3'
Posted On2013-11-18