Incidental Mutation 'R1072:Ppp3ca'
ID85493
Institutional Source Beutler Lab
Gene Symbol Ppp3ca
Ensembl Gene ENSMUSG00000028161
Gene Nameprotein phosphatase 3, catalytic subunit, alpha isoform
SynonymsCaln, PP2BA alpha, 2900074D19Rik, PP2B alpha 1, Calna, CnA, CN
MMRRC Submission 039158-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1072 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location136670124-136937727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136935127 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 480 (M480V)
Ref Sequence ENSEMBL: ENSMUSP00000071040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056758] [ENSMUST00000070198]
Predicted Effect probably benign
Transcript: ENSMUST00000056758
AA Change: M490V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053101
Gene: ENSMUSG00000028161
AA Change: M490V

DomainStartEndE-ValueType
PP2Ac 56 347 2.91e-162 SMART
low complexity region 507 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070198
AA Change: M480V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071040
Gene: ENSMUSG00000028161
AA Change: M480V

DomainStartEndE-ValueType
PP2Ac 56 347 2.91e-162 SMART
low complexity region 497 509 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased T cell proliferation and abnormal mossy fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 120,212,769 F191Y probably benign Het
Ankrd55 G T 13: 112,348,842 A169S possibly damaging Het
Ano2 A G 6: 126,039,324 E940G probably damaging Het
Atp2c1 A T 9: 105,459,744 H153Q possibly damaging Het
Ccnf A T 17: 24,237,162 V283D probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Clec4b2 T C 6: 123,204,274 I206T probably damaging Het
Gli3 T C 13: 15,713,605 V535A probably damaging Het
Hectd1 A T 12: 51,761,072 D1779E probably benign Het
Itgax A G 7: 128,150,144 N1154D probably damaging Het
Klra10 A T 6: 130,281,848 H25Q probably benign Het
Lpo A G 11: 87,818,434 S94P probably damaging Het
Mbd5 A T 2: 49,257,191 N471I probably damaging Het
Myo5c A G 9: 75,292,208 Y1366C probably damaging Het
Nbea A G 3: 56,086,196 I261T possibly damaging Het
Nlrp4a T C 7: 26,444,435 F75S probably damaging Het
Numa1 T A 7: 102,001,150 probably null Het
Ptpn23 A T 9: 110,386,595 M1367K probably benign Het
Rhobtb2 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 14: 69,787,527 probably benign Het
Sftpa1 C G 14: 41,133,635 probably null Het
Shank2 A T 7: 144,411,568 N1181I probably damaging Het
Slc6a20b T C 9: 123,598,459 T462A probably damaging Het
Spdye4c T C 2: 128,596,637 L305P probably benign Het
Th C A 7: 142,894,488 V275L probably benign Het
Ttn C T 2: 76,903,377 probably benign Het
Ush2a T C 1: 188,728,717 V2725A possibly damaging Het
Other mutations in Ppp3ca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Ppp3ca APN 3 136935181 missense probably benign 0.01
IGL01405:Ppp3ca APN 3 136868721 missense probably benign 0.33
IGL02061:Ppp3ca APN 3 136797863 missense probably benign
IGL02285:Ppp3ca APN 3 136928626 splice site probably benign
IGL02472:Ppp3ca APN 3 136921862 missense possibly damaging 0.57
IGL02706:Ppp3ca APN 3 136905318 missense possibly damaging 0.84
IGL02894:Ppp3ca APN 3 136797812 missense probably damaging 1.00
R0325:Ppp3ca UTSW 3 136935139 missense probably benign 0.15
R1427:Ppp3ca UTSW 3 136921914 missense probably damaging 1.00
R1524:Ppp3ca UTSW 3 136797818 missense probably benign
R1568:Ppp3ca UTSW 3 136928544 missense probably benign 0.00
R1754:Ppp3ca UTSW 3 136881448 missense probably benign 0.20
R1800:Ppp3ca UTSW 3 136935031 missense probably damaging 0.98
R1844:Ppp3ca UTSW 3 136921911 missense probably benign 0.08
R1878:Ppp3ca UTSW 3 136797878 missense probably benign 0.03
R2155:Ppp3ca UTSW 3 136890450 missense possibly damaging 0.95
R2160:Ppp3ca UTSW 3 136877630 missense probably damaging 1.00
R2220:Ppp3ca UTSW 3 136797924 missense probably damaging 1.00
R2331:Ppp3ca UTSW 3 136797819 missense probably benign
R3052:Ppp3ca UTSW 3 136797844 missense probably benign 0.00
R3500:Ppp3ca UTSW 3 136881512 missense probably benign 0.00
R4764:Ppp3ca UTSW 3 136890489 missense probably damaging 0.99
R4974:Ppp3ca UTSW 3 136935049 missense possibly damaging 0.60
R5952:Ppp3ca UTSW 3 136928571 missense probably benign 0.08
R6051:Ppp3ca UTSW 3 136876122 missense probably damaging 1.00
R6395:Ppp3ca UTSW 3 136877770 missense possibly damaging 0.47
R6975:Ppp3ca UTSW 3 136905301 missense probably damaging 1.00
R7121:Ppp3ca UTSW 3 136868626 missense probably damaging 1.00
R7720:Ppp3ca UTSW 3 136890489 missense probably damaging 1.00
R7773:Ppp3ca UTSW 3 136890461 missense probably benign
R7828:Ppp3ca UTSW 3 136797774 missense probably damaging 1.00
R7830:Ppp3ca UTSW 3 136868720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCCTTGGTTCCCTCCGGTATG -3'
(R):5'- ACTGCTGAGATGCAGCAATCCC -3'

Sequencing Primer
(F):5'- TCCCTCCGGTATGGTAAGGAATC -3'
(R):5'- GCTGCTATTACTGCCATTGC -3'
Posted On2013-11-18