Mutagenetix > Incidental Mutation

Incidental Mutation 'R1072:Cdh15'

85503

Institutional Source

Beutler Lab

Gene Symbol

Cdh15

Ensembl Gene

ENSMUSG00000031962

Gene Name

cadherin 15

Synonyms

M cadherin, Mcad, Cdh14

MMRRC Submission

039158-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1072 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

123575113-123594136 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 123588763 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 279 (R279Q)

Ref Sequence

ENSEMBL: ENSMUSP00000034443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034443] [ENSMUST00000127664]

AlphaFold

P33146

Predicted Effect

probably damaging
Transcript: ENSMUST00000034443
AA Change: R279Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000034443
Gene: ENSMUSG00000031962
AA Change: R279Q

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CA	64	149	5.95e-18	SMART
CA	173	257	3.09e-25	SMART
CA	280	373	2.5e-11	SMART
CA	396	480	3.45e-14	SMART
Pfam:Cadherin	486	579	5.2e-9	PFAM
transmembrane domain	603	625	N/A	INTRINSIC
Pfam:Cadherin_C	633	783	6.7e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.2%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Based on the expression of this gene in skeletal muscle, satellite cells and cerebellum, it was postulated that the encoded protein may be important for muscle development and regeneration. Mice lacking the encoded protein appear normal and display no discernible defects in skeletal musculature. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no apparent defects in the development, maintenance, or regeneration of skeletal muscle or in the cerebellum. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	A	7: 119,811,992 (GRCm39)	F191Y	probably benign	Het
Ankrd55	G	T	13: 112,485,376 (GRCm39)	A169S	possibly damaging	Het
Ano2	A	G	6: 126,016,287 (GRCm39)	E940G	probably damaging	Het
Atp2c1	A	T	9: 105,336,943 (GRCm39)	H153Q	possibly damaging	Het
Ccnf	A	T	17: 24,456,136 (GRCm39)	V283D	probably damaging	Het
Clec4b2	T	C	6: 123,181,233 (GRCm39)	I206T	probably damaging	Het
Gli3	T	C	13: 15,888,190 (GRCm39)	V535A	probably damaging	Het
Hectd1	A	T	12: 51,807,855 (GRCm39)	D1779E	probably benign	Het
Itgax	A	G	7: 127,749,316 (GRCm39)	N1154D	probably damaging	Het
Klra10	A	T	6: 130,258,811 (GRCm39)	H25Q	probably benign	Het
Lpo	A	G	11: 87,709,260 (GRCm39)	S94P	probably damaging	Het
Mbd5	A	T	2: 49,147,203 (GRCm39)	N471I	probably damaging	Het
Myo5c	A	G	9: 75,199,490 (GRCm39)	Y1366C	probably damaging	Het
Nbea	A	G	3: 55,993,617 (GRCm39)	I261T	possibly damaging	Het
Nlrp4a	T	C	7: 26,143,860 (GRCm39)	F75S	probably damaging	Het
Numa1	T	A	7: 101,650,357 (GRCm39)		probably null	Het
Ppp3ca	A	G	3: 136,640,888 (GRCm39)	M480V	probably benign	Het
Ptpn23	A	T	9: 110,215,663 (GRCm39)	M1367K	probably benign	Het
Rhobtb2	CGAGGAGGAGGAGGAGG	CGAGGAGGAGGAGG	14: 70,024,976 (GRCm39)		probably benign	Het
Sftpa1	C	G	14: 40,855,592 (GRCm39)		probably null	Het
Shank2	A	T	7: 143,965,305 (GRCm39)	N1181I	probably damaging	Het
Slc6a20b	T	C	9: 123,427,524 (GRCm39)	T462A	probably damaging	Het
Spdye4c	T	C	2: 128,438,557 (GRCm39)	L305P	probably benign	Het
Th	C	A	7: 142,448,225 (GRCm39)	V275L	probably benign	Het
Ttn	C	T	2: 76,733,721 (GRCm39)		probably benign	Het
Ush2a	T	C	1: 188,460,914 (GRCm39)	V2725A	possibly damaging	Het

Other mutations in Cdh15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cdh15	APN	8	123,592,062 (GRCm39)	intron	probably benign
IGL01958:Cdh15	APN	8	123,586,089 (GRCm39)	missense	probably damaging	1.00
IGL02588:Cdh15	APN	8	123,583,291 (GRCm39)	nonsense	probably null
IGL02793:Cdh15	APN	8	123,587,721 (GRCm39)	missense	probably damaging	1.00
IGL02947:Cdh15	APN	8	123,592,111 (GRCm39)	missense	probably benign	0.00
R0310:Cdh15	UTSW	8	123,592,175 (GRCm39)	missense	probably damaging	1.00
R0441:Cdh15	UTSW	8	123,587,705 (GRCm39)	missense	probably damaging	1.00
R0766:Cdh15	UTSW	8	123,588,188 (GRCm39)	intron	probably benign
R0898:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1023:Cdh15	UTSW	8	123,591,939 (GRCm39)	missense	probably damaging	0.98
R1054:Cdh15	UTSW	8	123,591,076 (GRCm39)	missense	possibly damaging	0.85
R1081:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1101:Cdh15	UTSW	8	123,587,585 (GRCm39)	missense	possibly damaging	0.93
R1208:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1208:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1209:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1210:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1312:Cdh15	UTSW	8	123,588,188 (GRCm39)	intron	probably benign
R1317:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1318:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1393:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1428:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1429:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1695:Cdh15	UTSW	8	123,588,755 (GRCm39)	missense	probably benign	0.05
R2157:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2170:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2178:Cdh15	UTSW	8	123,591,715 (GRCm39)	splice site	probably null
R2252:Cdh15	UTSW	8	123,584,161 (GRCm39)	missense	probably damaging	1.00
R2290:Cdh15	UTSW	8	123,586,056 (GRCm39)	missense	probably damaging	1.00
R2317:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2330:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2345:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2349:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2353:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2354:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2566:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2567:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2568:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2893:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2894:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2937:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2938:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2990:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2992:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2993:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3029:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3030:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3195:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R3441:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3442:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3608:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3686:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R4119:Cdh15	UTSW	8	123,590,162 (GRCm39)	missense	probably damaging	1.00
R4120:Cdh15	UTSW	8	123,590,162 (GRCm39)	missense	probably damaging	1.00
R4477:Cdh15	UTSW	8	123,591,415 (GRCm39)	missense	probably benign	0.00
R4478:Cdh15	UTSW	8	123,591,415 (GRCm39)	missense	probably benign	0.00
R4480:Cdh15	UTSW	8	123,591,415 (GRCm39)	missense	probably benign	0.00
R4580:Cdh15	UTSW	8	123,591,897 (GRCm39)	missense	probably damaging	0.99
R4583:Cdh15	UTSW	8	123,591,767 (GRCm39)	missense	probably damaging	0.98
R4619:Cdh15	UTSW	8	123,587,612 (GRCm39)	missense	probably damaging	1.00
R4694:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R4731:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R5076:Cdh15	UTSW	8	123,591,087 (GRCm39)	missense	possibly damaging	0.82
R5347:Cdh15	UTSW	8	123,588,802 (GRCm39)	missense	probably null	1.00
R5375:Cdh15	UTSW	8	123,591,839 (GRCm39)	missense	probably damaging	1.00
R5498:Cdh15	UTSW	8	123,591,917 (GRCm39)	missense	possibly damaging	0.79
R5778:Cdh15	UTSW	8	123,583,326 (GRCm39)	missense	possibly damaging	0.80
R6320:Cdh15	UTSW	8	123,591,086 (GRCm39)	missense	probably benign	0.01
R6570:Cdh15	UTSW	8	123,584,130 (GRCm39)	missense	probably damaging	1.00
R6708:Cdh15	UTSW	8	123,590,294 (GRCm39)	missense	probably benign	0.32
R7505:Cdh15	UTSW	8	123,575,231 (GRCm39)	missense	probably benign	0.01
R7527:Cdh15	UTSW	8	123,588,865 (GRCm39)	missense	probably damaging	1.00
R7724:Cdh15	UTSW	8	123,593,700 (GRCm39)	missense	probably damaging	1.00
R8093:Cdh15	UTSW	8	123,593,574 (GRCm39)	missense	probably damaging	1.00
R8485:Cdh15	UTSW	8	123,584,105 (GRCm39)	missense	probably damaging	1.00
R8759:Cdh15	UTSW	8	123,587,628 (GRCm39)	missense	probably damaging	1.00
R8910:Cdh15	UTSW	8	123,575,240 (GRCm39)	missense	probably benign	0.04
R9017:Cdh15	UTSW	8	123,584,256 (GRCm39)	critical splice donor site	probably null
R9453:Cdh15	UTSW	8	123,586,029 (GRCm39)	missense	probably damaging	0.99
R9699:Cdh15	UTSW	8	123,588,769 (GRCm39)	missense	probably benign	0.00
R9705:Cdh15	UTSW	8	123,591,024 (GRCm39)	missense	probably damaging	1.00
Z1176:Cdh15	UTSW	8	123,590,998 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGCAATGGTGTTAAGCCAGAAGC -3'
(R):5'- TGTAGCAATGGCAATCTGAGGGTG -3'

Sequencing Primer
(F):5'- CAGGGAAGGTATCCCGAGTC -3'
(R):5'- AGACACCTGTGATGGATTCTAGC -3'

Posted On

2013-11-18