Incidental Mutation 'R1072:Myo5c'
Institutional Source Beutler Lab
Gene Symbol Myo5c
Ensembl Gene ENSMUSG00000033590
Gene Namemyosin VC
MMRRC Submission 039158-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1072 (G1)
Quality Score225
Status Not validated
Chromosomal Location75232020-75305451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75292208 bp
Amino Acid Change Tyrosine to Cysteine at position 1366 (Y1366C)
Ref Sequence ENSEMBL: ENSMUSP00000042229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036555] [ENSMUST00000216788]
Predicted Effect probably damaging
Transcript: ENSMUST00000036555
AA Change: Y1366C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042229
Gene: ENSMUSG00000033590
AA Change: Y1366C

MYSc 61 754 N/A SMART
IQ 755 777 1.11e-3 SMART
IQ 778 800 1.39e0 SMART
IQ 806 828 8.98e-4 SMART
IQ 829 851 4.19e-4 SMART
IQ 854 876 2.54e-3 SMART
coiled coil region 1160 1185 N/A INTRINSIC
coiled coil region 1207 1245 N/A INTRINSIC
DIL 1574 1679 5.54e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215620
Predicted Effect probably benign
Transcript: ENSMUST00000216788
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 120,212,769 F191Y probably benign Het
Ankrd55 G T 13: 112,348,842 A169S possibly damaging Het
Ano2 A G 6: 126,039,324 E940G probably damaging Het
Atp2c1 A T 9: 105,459,744 H153Q possibly damaging Het
Ccnf A T 17: 24,237,162 V283D probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Clec4b2 T C 6: 123,204,274 I206T probably damaging Het
Gli3 T C 13: 15,713,605 V535A probably damaging Het
Hectd1 A T 12: 51,761,072 D1779E probably benign Het
Itgax A G 7: 128,150,144 N1154D probably damaging Het
Klra10 A T 6: 130,281,848 H25Q probably benign Het
Lpo A G 11: 87,818,434 S94P probably damaging Het
Mbd5 A T 2: 49,257,191 N471I probably damaging Het
Nbea A G 3: 56,086,196 I261T possibly damaging Het
Nlrp4a T C 7: 26,444,435 F75S probably damaging Het
Numa1 T A 7: 102,001,150 probably null Het
Ppp3ca A G 3: 136,935,127 M480V probably benign Het
Ptpn23 A T 9: 110,386,595 M1367K probably benign Het
Rhobtb2 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 14: 69,787,527 probably benign Het
Sftpa1 C G 14: 41,133,635 probably null Het
Shank2 A T 7: 144,411,568 N1181I probably damaging Het
Slc6a20b T C 9: 123,598,459 T462A probably damaging Het
Spdye4c T C 2: 128,596,637 L305P probably benign Het
Th C A 7: 142,894,488 V275L probably benign Het
Ttn C T 2: 76,903,377 probably benign Het
Ush2a T C 1: 188,728,717 V2725A possibly damaging Het
Other mutations in Myo5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Myo5c APN 9 75242880 splice site probably benign
IGL00848:Myo5c APN 9 75289181 missense probably benign
IGL01503:Myo5c APN 9 75263042 missense probably damaging 1.00
IGL01735:Myo5c APN 9 75301438 missense probably damaging 1.00
IGL01866:Myo5c APN 9 75269582 missense probably benign 0.00
IGL01956:Myo5c APN 9 75242876 splice site probably null
IGL02127:Myo5c APN 9 75300902 missense probably damaging 1.00
IGL02268:Myo5c APN 9 75246237 missense probably damaging 1.00
IGL02272:Myo5c APN 9 75266160 missense possibly damaging 0.73
IGL03052:Myo5c APN 9 75252516 splice site probably benign
IGL03179:Myo5c APN 9 75255866 missense possibly damaging 0.65
IGL03224:Myo5c APN 9 75278243 missense probably benign 0.01
PIT4142001:Myo5c UTSW 9 75283948 missense probably benign 0.00
PIT4431001:Myo5c UTSW 9 75252571 missense possibly damaging 0.75
R0126:Myo5c UTSW 9 75269525 missense probably benign 0.05
R0266:Myo5c UTSW 9 75284216 splice site probably benign
R0345:Myo5c UTSW 9 75297419 missense probably damaging 1.00
R0387:Myo5c UTSW 9 75285021 splice site probably benign
R0602:Myo5c UTSW 9 75266196 splice site probably null
R0675:Myo5c UTSW 9 75278289 missense probably benign
R0798:Myo5c UTSW 9 75257984 missense probably damaging 1.00
R0981:Myo5c UTSW 9 75271591 missense probably damaging 1.00
R1051:Myo5c UTSW 9 75290883 missense probably benign 0.00
R1144:Myo5c UTSW 9 75286448 missense probably damaging 1.00
R1454:Myo5c UTSW 9 75263066 missense possibly damaging 0.94
R1476:Myo5c UTSW 9 75275939 missense probably damaging 1.00
R1484:Myo5c UTSW 9 75300810 missense probably damaging 1.00
R1586:Myo5c UTSW 9 75267031 missense probably damaging 0.99
R1616:Myo5c UTSW 9 75296017 missense probably damaging 1.00
R1635:Myo5c UTSW 9 75277075 missense probably benign 0.09
R1800:Myo5c UTSW 9 75246164 missense probably damaging 1.00
R1838:Myo5c UTSW 9 75273553 missense probably damaging 1.00
R1840:Myo5c UTSW 9 75249735 missense probably damaging 1.00
R1885:Myo5c UTSW 9 75249761 missense probably damaging 1.00
R1897:Myo5c UTSW 9 75292241 missense probably benign 0.20
R1898:Myo5c UTSW 9 75297626 missense probably damaging 1.00
R2029:Myo5c UTSW 9 75289055 unclassified probably benign
R2063:Myo5c UTSW 9 75281868 missense probably benign 0.19
R2230:Myo5c UTSW 9 75273606 missense probably benign
R2519:Myo5c UTSW 9 75250436 missense probably damaging 1.00
R2520:Myo5c UTSW 9 75297649 nonsense probably null
R3034:Myo5c UTSW 9 75286577 missense probably benign 0.44
R3117:Myo5c UTSW 9 75266194 critical splice donor site probably null
R3432:Myo5c UTSW 9 75263001 missense probably damaging 1.00
R3751:Myo5c UTSW 9 75276002 missense probably damaging 1.00
R4132:Myo5c UTSW 9 75252568 missense probably benign 0.00
R4173:Myo5c UTSW 9 75246258 missense probably damaging 1.00
R4239:Myo5c UTSW 9 75283942 missense probably benign 0.01
R4429:Myo5c UTSW 9 75294001 missense probably damaging 1.00
R4574:Myo5c UTSW 9 75269611 missense probably benign 0.00
R4791:Myo5c UTSW 9 75290916 missense probably damaging 1.00
R4804:Myo5c UTSW 9 75245024 missense probably damaging 1.00
R4819:Myo5c UTSW 9 75292202 missense probably damaging 0.97
R4881:Myo5c UTSW 9 75284152 missense probably benign 0.00
R4900:Myo5c UTSW 9 75273543 missense probably damaging 1.00
R4964:Myo5c UTSW 9 75297509 missense possibly damaging 0.51
R4966:Myo5c UTSW 9 75269596 missense probably benign 0.03
R5057:Myo5c UTSW 9 75300873 missense probably damaging 1.00
R5347:Myo5c UTSW 9 75295205 missense probably null 1.00
R5399:Myo5c UTSW 9 75288074 missense possibly damaging 0.80
R5440:Myo5c UTSW 9 75258125 missense possibly damaging 0.91
R5569:Myo5c UTSW 9 75273510 missense probably damaging 1.00
R5600:Myo5c UTSW 9 75289154 missense probably benign 0.00
R5606:Myo5c UTSW 9 75275508 missense probably damaging 1.00
R5704:Myo5c UTSW 9 75272903 missense probably benign 0.00
R5798:Myo5c UTSW 9 75284198 missense probably benign 0.04
R5865:Myo5c UTSW 9 75297488 missense probably damaging 0.97
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6143:Myo5c UTSW 9 75249809 missense probably damaging 1.00
R6242:Myo5c UTSW 9 75273611 missense probably benign
R6253:Myo5c UTSW 9 75245037 missense probably damaging 1.00
R6264:Myo5c UTSW 9 75275554 missense probably benign
R6307:Myo5c UTSW 9 75272916 missense possibly damaging 0.73
R6358:Myo5c UTSW 9 75296012 missense possibly damaging 0.53
R6450:Myo5c UTSW 9 75286578 missense probably benign 0.26
R6598:Myo5c UTSW 9 75246234 missense probably damaging 1.00
R6618:Myo5c UTSW 9 75275637 critical splice donor site probably null
R6774:Myo5c UTSW 9 75289186 missense probably benign 0.05
R6865:Myo5c UTSW 9 75269596 missense probably benign 0.03
R6996:Myo5c UTSW 9 75250464 missense probably benign 0.01
R7023:Myo5c UTSW 9 75301456 missense probably damaging 0.98
R7123:Myo5c UTSW 9 75289223 missense probably benign
R7250:Myo5c UTSW 9 75262215 missense probably damaging 1.00
R7316:Myo5c UTSW 9 75269638 missense probably benign 0.00
R7340:Myo5c UTSW 9 75289141 missense probably benign
R7382:Myo5c UTSW 9 75304050 missense probably damaging 1.00
R7788:Myo5c UTSW 9 75279345 missense probably damaging 0.98
Z1088:Myo5c UTSW 9 75245059 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cctacccaaacccacatctaac -3'
Posted On2013-11-18