Mutagenetix > Incidental Mutations

Incidental Mutation 'R1073:Pyroxd1'

85523

Institutional Source

Beutler Lab

Gene Symbol

Pyroxd1

Ensembl Gene

ENSMUSG00000041671

Gene Name

pyridine nucleotide-disulphide oxidoreductase domain 1

Synonyms

MMRRC Submission

039159-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1073 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

142345654-142363257 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 142348644 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000036394 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032370] [ENSMUST00000041852]

Predicted Effect

probably benign
Transcript: ENSMUST00000032370

SMART Domains

Protein: ENSMUSP00000032370
Gene: ENSMUSG00000030243

Domain	Start	End	E-Value	Type
coiled coil region	6	51	N/A	INTRINSIC
DEXDc	88	291	2.5e-27	SMART
HELICc	328	409	2.2e-26	SMART
Pfam:RQC	488	592	5.5e-6	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000041852

SMART Domains

Protein: ENSMUSP00000036394
Gene: ENSMUSG00000041671

Domain	Start	End	E-Value	Type
Pfam:Pyr_redox_2	8	234	2.2e-18	PFAM
Pfam:Pyr_redox_2	266	381	4e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123289

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137098

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153912

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204971

Meta Mutation Damage Score

0.9495

Coding Region Coverage

1x: 99.7%
3x: 99.1%
10x: 97.5%
20x: 94.5%

Validation Efficiency

98% (40/41)

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asap3	T	C	4: 136,236,431	I334T	probably damaging	Het
Atxn7l3	C	G	11: 102,292,435		probably benign	Het
Cacna2d3	T	A	14: 29,045,623	H765L	probably damaging	Het
Cngb1	A	G	8: 95,303,567		probably null	Het
Csmd1	C	T	8: 16,358,463		probably benign	Het
Cux1	A	T	5: 136,252,541		probably null	Het
D7Ertd443e	T	C	7: 134,270,218	K232R	probably damaging	Het
Dock6	A	G	9: 21,846,518	S97P	probably benign	Het
Eml5	G	A	12: 98,830,973	A1099V	probably damaging	Het
Gtf2h1	G	A	7: 46,816,944	A472T	probably damaging	Het
Krt82	T	A	15: 101,550,254	D117V	probably damaging	Het
Lrfn5	A	G	12: 61,840,809	Y461C	probably damaging	Het
Mkl2	T	A	16: 13,412,318	S956T	possibly damaging	Het
Mmrn2	G	A	14: 34,396,294		probably null	Het
Msrb3	T	A	10: 120,784,136	S93C	possibly damaging	Het
Ncl	AAAGCCTCCC	AAAGCCTCCCAAGCCTCCC	1: 86,350,816		probably benign	Het
Olfr228	A	G	2: 86,483,640	I34T	probably damaging	Het
Osbpl10	C	T	9: 115,207,553	Q381*	probably null	Het
Pelp1	A	G	11: 70,396,590	L464P	probably damaging	Het
Pigs	A	G	11: 78,335,605	D216G	probably benign	Het
Ptprk	T	C	10: 28,496,947		probably null	Het
Ros1	T	A	10: 52,046,125	D2284V	probably damaging	Het
Rptor	T	C	11: 119,743,891	S178P	possibly damaging	Het
Slc8a1	C	T	17: 81,648,407	D401N	probably damaging	Het
Tas2r143	T	C	6: 42,400,760	Y175H	probably benign	Het
Tdrd9	T	C	12: 112,023,259	S502P	probably damaging	Het
Tmem38a	A	G	8: 72,580,103	H142R	probably damaging	Het
Tmem44	A	G	16: 30,514,833		probably benign	Het
Ugt2b38	T	G	5: 87,412,373	N361H	probably damaging	Het
Umod	A	G	7: 119,464,741	V614A	possibly damaging	Het
Vmn2r5	A	T	3: 64,491,305	L751*	probably null	Het
Wdr37	A	T	13: 8,805,840	I489N	probably damaging	Het
Xdh	T	C	17: 73,939,836	T78A	probably benign	Het
Zfp866	A	T	8: 69,767,622		probably benign	Het

Other mutations in Pyroxd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01335:Pyroxd1	APN	6	142361758	missense	probably damaging	0.96
IGL01720:Pyroxd1	APN	6	142351058	splice site	probably benign
IGL02139:Pyroxd1	APN	6	142354731	missense	probably benign
IGL02930:Pyroxd1	APN	6	142359052	missense	probably damaging	1.00
R0233:Pyroxd1	UTSW	6	142354630	missense	possibly damaging	0.77
R0233:Pyroxd1	UTSW	6	142354630	missense	possibly damaging	0.77
R0329:Pyroxd1	UTSW	6	142361976	missense	probably benign	0.37
R0505:Pyroxd1	UTSW	6	142353562	missense	possibly damaging	0.55
R0552:Pyroxd1	UTSW	6	142345737	missense	probably benign	0.06
R1319:Pyroxd1	UTSW	6	142359148	missense	probably benign	0.33
R2200:Pyroxd1	UTSW	6	142359082	missense	probably benign	0.01
R4638:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4639:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4640:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4641:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4642:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4643:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4645:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4687:Pyroxd1	UTSW	6	142361868	missense	probably benign	0.00
R5359:Pyroxd1	UTSW	6	142361991	missense	probably damaging	1.00
R5688:Pyroxd1	UTSW	6	142353540	missense	probably damaging	1.00
R6208:Pyroxd1	UTSW	6	142357456	missense	probably benign	0.00
R6295:Pyroxd1	UTSW	6	142354753	missense	probably benign	0.00
R7056:Pyroxd1	UTSW	6	142359082	missense	probably benign	0.01
R7445:Pyroxd1	UTSW	6	142358501	missense	probably benign	0.03
V1662:Pyroxd1	UTSW	6	142358443	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CAGAGACCGCCAGACCTTTAACTTG -3'
(R):5'- TCCGCTGTATGTCAGTGCCTTG -3'

Sequencing Primer
(F):5'- CTTTGGGAGATATAAGAGATCAAACC -3'
(R):5'- GGATCATGGGTATTCTACAAACACC -3'

Posted On

2013-11-18