Incidental Mutation 'R1073:Gtf2h1'
ID85524
Institutional Source Beutler Lab
Gene Symbol Gtf2h1
Ensembl Gene ENSMUSG00000006599
Gene Namegeneral transcription factor II H, polypeptide 1
Synonymsp62, 62kDa
MMRRC Submission 039159-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R1073 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location46796103-46823800 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46816944 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 472 (A472T)
Ref Sequence ENSEMBL: ENSMUSP00000103271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006774] [ENSMUST00000107644] [ENSMUST00000128420]
Predicted Effect probably damaging
Transcript: ENSMUST00000006774
AA Change: A466T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006774
Gene: ENSMUSG00000006599
AA Change: A466T

DomainStartEndE-ValueType
Pfam:TFIIH_BTF_p62_N 9 81 6.8e-25 PFAM
BSD 99 154 8.89e-11 SMART
BSD 179 231 2.09e-16 SMART
low complexity region 417 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107644
AA Change: A472T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103271
Gene: ENSMUSG00000006599
AA Change: A472T

DomainStartEndE-ValueType
Pfam:PH_TFIIH 22 103 8.5e-29 PFAM
BSD 105 160 8.89e-11 SMART
BSD 185 237 2.09e-16 SMART
low complexity region 423 440 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119337
Predicted Effect probably benign
Transcript: ENSMUST00000128420
SMART Domains Protein: ENSMUSP00000120008
Gene: ENSMUSG00000006599

DomainStartEndE-ValueType
Pfam:TFIIH_BTF_p62_N 9 51 1.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144708
Meta Mutation Damage Score 0.3225 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.5%
  • 20x: 94.5%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap3 T C 4: 136,236,431 I334T probably damaging Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Cacna2d3 T A 14: 29,045,623 H765L probably damaging Het
Cngb1 A G 8: 95,303,567 probably null Het
Csmd1 C T 8: 16,358,463 probably benign Het
Cux1 A T 5: 136,252,541 probably null Het
D7Ertd443e T C 7: 134,270,218 K232R probably damaging Het
Dock6 A G 9: 21,846,518 S97P probably benign Het
Eml5 G A 12: 98,830,973 A1099V probably damaging Het
Krt82 T A 15: 101,550,254 D117V probably damaging Het
Lrfn5 A G 12: 61,840,809 Y461C probably damaging Het
Mkl2 T A 16: 13,412,318 S956T possibly damaging Het
Mmrn2 G A 14: 34,396,294 probably null Het
Msrb3 T A 10: 120,784,136 S93C possibly damaging Het
Ncl AAAGCCTCCC AAAGCCTCCCAAGCCTCCC 1: 86,350,816 probably benign Het
Olfr228 A G 2: 86,483,640 I34T probably damaging Het
Osbpl10 C T 9: 115,207,553 Q381* probably null Het
Pelp1 A G 11: 70,396,590 L464P probably damaging Het
Pigs A G 11: 78,335,605 D216G probably benign Het
Ptprk T C 10: 28,496,947 probably null Het
Pyroxd1 T C 6: 142,348,644 probably null Het
Ros1 T A 10: 52,046,125 D2284V probably damaging Het
Rptor T C 11: 119,743,891 S178P possibly damaging Het
Slc8a1 C T 17: 81,648,407 D401N probably damaging Het
Tas2r143 T C 6: 42,400,760 Y175H probably benign Het
Tdrd9 T C 12: 112,023,259 S502P probably damaging Het
Tmem38a A G 8: 72,580,103 H142R probably damaging Het
Tmem44 A G 16: 30,514,833 probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Umod A G 7: 119,464,741 V614A possibly damaging Het
Vmn2r5 A T 3: 64,491,305 L751* probably null Het
Wdr37 A T 13: 8,805,840 I489N probably damaging Het
Xdh T C 17: 73,939,836 T78A probably benign Het
Zfp866 A T 8: 69,767,622 probably benign Het
Other mutations in Gtf2h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Gtf2h1 APN 7 46819210 missense possibly damaging 0.90
IGL01108:Gtf2h1 APN 7 46812498 missense probably damaging 1.00
IGL02054:Gtf2h1 APN 7 46815425 splice site probably benign
IGL02075:Gtf2h1 APN 7 46801741 missense probably damaging 1.00
IGL02309:Gtf2h1 APN 7 46816388 missense probably damaging 0.99
IGL02423:Gtf2h1 APN 7 46815400 missense probably benign
IGL02481:Gtf2h1 APN 7 46804993 missense probably damaging 1.00
IGL03159:Gtf2h1 APN 7 46806743 missense possibly damaging 0.80
R0136:Gtf2h1 UTSW 7 46815416 missense possibly damaging 0.49
R1242:Gtf2h1 UTSW 7 46812751 critical splice donor site probably null
R1469:Gtf2h1 UTSW 7 46805125 critical splice donor site probably null
R1469:Gtf2h1 UTSW 7 46805125 critical splice donor site probably null
R1740:Gtf2h1 UTSW 7 46812466 missense probably null
R2192:Gtf2h1 UTSW 7 46815323 missense possibly damaging 0.73
R3012:Gtf2h1 UTSW 7 46803895 missense probably damaging 1.00
R4238:Gtf2h1 UTSW 7 46805065 missense probably benign
R4239:Gtf2h1 UTSW 7 46805065 missense probably benign
R4715:Gtf2h1 UTSW 7 46815412 missense possibly damaging 0.66
R4776:Gtf2h1 UTSW 7 46822878 nonsense probably null
R6193:Gtf2h1 UTSW 7 46806830 critical splice donor site probably null
R6338:Gtf2h1 UTSW 7 46816456 missense probably benign
R6556:Gtf2h1 UTSW 7 46808665 missense probably damaging 1.00
R7102:Gtf2h1 UTSW 7 46819126 missense probably benign 0.21
R8232:Gtf2h1 UTSW 7 46801679 missense probably benign 0.02
RF021:Gtf2h1 UTSW 7 46803865 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TAGTAGCACCATCACAGCCCTGTC -3'
(R):5'- TCCTAAGCTGGCCCAAGGTAATGC -3'

Sequencing Primer
(F):5'- gttctctcctctctgtaagttcc -3'
(R):5'- GCCCAAGGTAATGCATGTTC -3'
Posted On2013-11-18