Incidental Mutation 'R1073:Umod'
ID85526
Institutional Source Beutler Lab
Gene Symbol Umod
Ensembl Gene ENSMUSG00000030963
Gene Nameuromodulin
Synonymsuromucoid, urehr4, Urehd1, Tamm-Horsfall glycoprotein
MMRRC Submission 039159-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R1073 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location119462711-119479282 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119464741 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 614 (V614A)
Ref Sequence ENSEMBL: ENSMUSP00000146652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033263] [ENSMUST00000209095]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033263
AA Change: V614A

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033263
Gene: ENSMUSG00000030963
AA Change: V614A

DomainStartEndE-ValueType
EGF 31 64 4.03e-1 SMART
EGF_CA 65 106 3.81e-11 SMART
EGF_CA 107 155 4.81e-8 SMART
Blast:ZP 256 325 6e-30 BLAST
ZP 335 586 2.19e-70 SMART
low complexity region 619 634 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208401
Predicted Effect possibly damaging
Transcript: ENSMUST00000209095
AA Change: V614A

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.0700 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.5%
  • 20x: 94.5%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: This gene encodes a glycoprotein that is the most abundant protein in mammalian urine under physiological conditions. It is synthesized in the kidney as a glycosyl-phosphatidylinositol anchored protein and released into urine as a soluble form by proteolytic cleavage. It is thought to regulate water and salt balance in the thick ascending limb of Henle and to protect against urinary tract infection and calcium oxalate crystal formation. In mouse deficiency of this gene is associated with increased susceptibility to bacterial infections and formation of calcium crystals in kidneys. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous inactivation of this gene causes renal dysfunction and increased susceptibility to bladder infection, and may lead to renal calcinosis and stone formation. Homozygotes for an ENU-induced allele exhibit renal dysfunction and alterations in ureahandling, energy, bone, and lipid metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap3 T C 4: 136,236,431 I334T probably damaging Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Cacna2d3 T A 14: 29,045,623 H765L probably damaging Het
Cngb1 A G 8: 95,303,567 probably null Het
Csmd1 C T 8: 16,358,463 probably benign Het
Cux1 A T 5: 136,252,541 probably null Het
D7Ertd443e T C 7: 134,270,218 K232R probably damaging Het
Dock6 A G 9: 21,846,518 S97P probably benign Het
Eml5 G A 12: 98,830,973 A1099V probably damaging Het
Gtf2h1 G A 7: 46,816,944 A472T probably damaging Het
Krt82 T A 15: 101,550,254 D117V probably damaging Het
Lrfn5 A G 12: 61,840,809 Y461C probably damaging Het
Mkl2 T A 16: 13,412,318 S956T possibly damaging Het
Mmrn2 G A 14: 34,396,294 probably null Het
Msrb3 T A 10: 120,784,136 S93C possibly damaging Het
Ncl AAAGCCTCCC AAAGCCTCCCAAGCCTCCC 1: 86,350,816 probably benign Het
Olfr228 A G 2: 86,483,640 I34T probably damaging Het
Osbpl10 C T 9: 115,207,553 Q381* probably null Het
Pelp1 A G 11: 70,396,590 L464P probably damaging Het
Pigs A G 11: 78,335,605 D216G probably benign Het
Ptprk T C 10: 28,496,947 probably null Het
Pyroxd1 T C 6: 142,348,644 probably null Het
Ros1 T A 10: 52,046,125 D2284V probably damaging Het
Rptor T C 11: 119,743,891 S178P possibly damaging Het
Slc8a1 C T 17: 81,648,407 D401N probably damaging Het
Tas2r143 T C 6: 42,400,760 Y175H probably benign Het
Tdrd9 T C 12: 112,023,259 S502P probably damaging Het
Tmem38a A G 8: 72,580,103 H142R probably damaging Het
Tmem44 A G 16: 30,514,833 probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vmn2r5 A T 3: 64,491,305 L751* probably null Het
Wdr37 A T 13: 8,805,840 I489N probably damaging Het
Xdh T C 17: 73,939,836 T78A probably benign Het
Zfp866 A T 8: 69,767,622 probably benign Het
Other mutations in Umod
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Umod APN 7 119477219 missense possibly damaging 0.93
IGL02527:Umod APN 7 119469467 missense probably damaging 1.00
R0265:Umod UTSW 7 119466073 missense probably benign 0.00
R1117:Umod UTSW 7 119477306 missense possibly damaging 0.71
R1515:Umod UTSW 7 119465497 missense probably benign 0.00
R1774:Umod UTSW 7 119477351 missense possibly damaging 0.82
R1803:Umod UTSW 7 119464724 missense probably damaging 0.96
R1864:Umod UTSW 7 119463255 missense probably damaging 0.99
R1942:Umod UTSW 7 119476932 missense probably damaging 1.00
R2060:Umod UTSW 7 119476715 missense probably damaging 0.97
R2354:Umod UTSW 7 119466193 missense probably damaging 1.00
R3015:Umod UTSW 7 119472540 missense probably damaging 1.00
R3030:Umod UTSW 7 119476839 missense probably benign 0.02
R4016:Umod UTSW 7 119476690 missense possibly damaging 0.56
R4406:Umod UTSW 7 119466064 missense probably damaging 1.00
R4446:Umod UTSW 7 119466056 splice site probably null
R5062:Umod UTSW 7 119472421 nonsense probably null
R5358:Umod UTSW 7 119472354 missense probably damaging 1.00
R5935:Umod UTSW 7 119471427 missense probably damaging 1.00
R6045:Umod UTSW 7 119476823 missense probably benign
R6239:Umod UTSW 7 119477297 missense probably damaging 1.00
R7111:Umod UTSW 7 119477146 nonsense probably null
R7168:Umod UTSW 7 119478326 splice site probably benign
R7265:Umod UTSW 7 119466073 missense probably benign 0.00
R7273:Umod UTSW 7 119477027 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CAAGACAAAGCACTTCGTGGCAG -3'
(R):5'- TGGATAAACTCTCGTAGGTGGGGC -3'

Sequencing Primer
(F):5'- ACTTCGTGGCAGCTCAG -3'
(R):5'- CATTCTTCTGAGGTCAATGGGAC -3'
Posted On2013-11-18