Incidental Mutation 'R1073:Zfp866'
ID85529
Institutional Source Beutler Lab
Gene Symbol Zfp866
Ensembl Gene ENSMUSG00000043090
Gene Namezinc finger protein 866
Synonyms9830167H18Rik, D330038O06Rik
MMRRC Submission 039159-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1073 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location69761326-69791178 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 69767622 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000131784] [ENSMUST00000137573] [ENSMUST00000149782]
Predicted Effect probably benign
Transcript: ENSMUST00000126915
SMART Domains Protein: ENSMUSP00000122850
Gene: ENSMUSG00000092544

DomainStartEndE-ValueType
KRAB 16 73 1.96e-17 SMART
PDB:2I13|B 104 210 3e-6 PDB
SCOP:d1fgja_ 114 216 2e-6 SMART
Blast:KRAB 189 209 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131784
SMART Domains Protein: ENSMUSP00000116972
Gene: ENSMUSG00000043090

DomainStartEndE-ValueType
Blast:KRAB 1 35 2e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137573
SMART Domains Protein: ENSMUSP00000119781
Gene: ENSMUSG00000043090

DomainStartEndE-ValueType
KRAB 4 67 4.26e-18 SMART
ZnF_C2H2 162 184 6.42e-4 SMART
ZnF_C2H2 190 212 3.69e-4 SMART
ZnF_C2H2 218 240 3.89e-3 SMART
ZnF_C2H2 246 268 3.34e-2 SMART
ZnF_C2H2 274 296 1.76e-1 SMART
ZnF_C2H2 302 324 5.42e-2 SMART
ZnF_C2H2 330 352 1.38e-3 SMART
ZnF_C2H2 358 380 6.78e-3 SMART
ZnF_C2H2 386 408 2.09e-3 SMART
ZnF_C2H2 414 436 9.44e-2 SMART
ZnF_C2H2 442 464 2.95e-3 SMART
ZnF_C2H2 470 492 9.73e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149782
SMART Domains Protein: ENSMUSP00000123252
Gene: ENSMUSG00000092544

DomainStartEndE-ValueType
KRAB 80 139 1.2e-17 SMART
ZnF_C2H2 155 177 1.69e-3 SMART
ZnF_C2H2 182 204 8.47e-4 SMART
ZnF_C2H2 210 232 7.15e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.5%
  • 20x: 94.5%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap3 T C 4: 136,236,431 I334T probably damaging Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Cacna2d3 T A 14: 29,045,623 H765L probably damaging Het
Cngb1 A G 8: 95,303,567 probably null Het
Csmd1 C T 8: 16,358,463 probably benign Het
Cux1 A T 5: 136,252,541 probably null Het
D7Ertd443e T C 7: 134,270,218 K232R probably damaging Het
Dock6 A G 9: 21,846,518 S97P probably benign Het
Eml5 G A 12: 98,830,973 A1099V probably damaging Het
Gtf2h1 G A 7: 46,816,944 A472T probably damaging Het
Krt82 T A 15: 101,550,254 D117V probably damaging Het
Lrfn5 A G 12: 61,840,809 Y461C probably damaging Het
Mkl2 T A 16: 13,412,318 S956T possibly damaging Het
Mmrn2 G A 14: 34,396,294 probably null Het
Msrb3 T A 10: 120,784,136 S93C possibly damaging Het
Ncl AAAGCCTCCC AAAGCCTCCCAAGCCTCCC 1: 86,350,816 probably benign Het
Olfr228 A G 2: 86,483,640 I34T probably damaging Het
Osbpl10 C T 9: 115,207,553 Q381* probably null Het
Pelp1 A G 11: 70,396,590 L464P probably damaging Het
Pigs A G 11: 78,335,605 D216G probably benign Het
Ptprk T C 10: 28,496,947 probably null Het
Pyroxd1 T C 6: 142,348,644 probably null Het
Ros1 T A 10: 52,046,125 D2284V probably damaging Het
Rptor T C 11: 119,743,891 S178P possibly damaging Het
Slc8a1 C T 17: 81,648,407 D401N probably damaging Het
Tas2r143 T C 6: 42,400,760 Y175H probably benign Het
Tdrd9 T C 12: 112,023,259 S502P probably damaging Het
Tmem38a A G 8: 72,580,103 H142R probably damaging Het
Tmem44 A G 16: 30,514,833 probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Umod A G 7: 119,464,741 V614A possibly damaging Het
Vmn2r5 A T 3: 64,491,305 L751* probably null Het
Wdr37 A T 13: 8,805,840 I489N probably damaging Het
Xdh T C 17: 73,939,836 T78A probably benign Het
Other mutations in Zfp866
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02755:Zfp866 APN 8 69766640 critical splice donor site probably null
R0238:Zfp866 UTSW 8 69766715 missense probably damaging 1.00
R1226:Zfp866 UTSW 8 69766290 missense probably damaging 1.00
R1388:Zfp866 UTSW 8 69766184 missense probably benign 0.16
R5129:Zfp866 UTSW 8 69767709 intron probably null
R5204:Zfp866 UTSW 8 69766040 missense probably damaging 0.96
R5225:Zfp866 UTSW 8 69765441 missense possibly damaging 0.93
R5504:Zfp866 UTSW 8 69765691 missense probably benign 0.07
R5912:Zfp866 UTSW 8 69766284 missense probably benign 0.03
R6046:Zfp866 UTSW 8 69765723 missense probably damaging 1.00
R6939:Zfp866 UTSW 8 69766221 missense probably damaging 0.99
R7033:Zfp866 UTSW 8 69765841 missense probably damaging 1.00
R7111:Zfp866 UTSW 8 69766571 missense probably benign 0.05
R7351:Zfp866 UTSW 8 69765897 missense probably damaging 1.00
R7458:Zfp866 UTSW 8 69765552 nonsense probably null
R8098:Zfp866 UTSW 8 69765978 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCAAGGTGTAGGTCAGACACTGCTC -3'
(R):5'- AGGTGGCGTGACTAACGCTGTG -3'

Sequencing Primer
(F):5'- cctccccagagcaataatctaatac -3'
(R):5'- atgagggcagagggcag -3'
Posted On2013-11-18