Incidental Mutation 'R1073:Lrfn5'
ID85542
Institutional Source Beutler Lab
Gene Symbol Lrfn5
Ensembl Gene ENSMUSG00000035653
Gene Nameleucine rich repeat and fibronectin type III domain containing 5
Synonyms
MMRRC Submission 039159-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R1073 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location61523150-61858342 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61840809 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 461 (Y461C)
Ref Sequence ENSEMBL: ENSMUSP00000113123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055815] [ENSMUST00000119481]
Predicted Effect probably damaging
Transcript: ENSMUST00000055815
AA Change: Y461C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051546
Gene: ENSMUSG00000035653
AA Change: Y461C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 19 55 1.11e1 SMART
LRR 74 97 3.07e-1 SMART
LRR_TYP 98 121 1.2e-3 SMART
LRR_TYP 122 145 8.94e-3 SMART
LRR 146 169 6.58e0 SMART
LRR_TYP 170 193 8.34e-3 SMART
LRR 194 218 2.47e1 SMART
LRRCT 240 285 1.65e-2 SMART
IGc2 299 364 3.53e-13 SMART
low complexity region 393 412 N/A INTRINSIC
Blast:FN3 414 495 2e-48 BLAST
transmembrane domain 528 550 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119481
AA Change: Y461C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113123
Gene: ENSMUSG00000035653
AA Change: Y461C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 19 55 1.11e1 SMART
LRR 74 97 3.07e-1 SMART
LRR_TYP 98 121 1.2e-3 SMART
LRR_TYP 122 145 8.94e-3 SMART
LRR 146 169 6.58e0 SMART
LRR_TYP 170 193 8.34e-3 SMART
LRR 194 218 2.47e1 SMART
LRRCT 240 285 1.65e-2 SMART
IGc2 299 364 3.53e-13 SMART
low complexity region 393 412 N/A INTRINSIC
Blast:FN3 414 495 2e-48 BLAST
transmembrane domain 528 550 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
Meta Mutation Damage Score 0.4819 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.5%
  • 20x: 94.5%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the leucine-rich repeat and fibronectin type III domain-containing family of proteins. A similar protein in mouse, a glycosylated transmembrane protein, is thought to function in presynaptic differentiation. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap3 T C 4: 136,236,431 I334T probably damaging Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Cacna2d3 T A 14: 29,045,623 H765L probably damaging Het
Cngb1 A G 8: 95,303,567 probably null Het
Csmd1 C T 8: 16,358,463 probably benign Het
Cux1 A T 5: 136,252,541 probably null Het
D7Ertd443e T C 7: 134,270,218 K232R probably damaging Het
Dock6 A G 9: 21,846,518 S97P probably benign Het
Eml5 G A 12: 98,830,973 A1099V probably damaging Het
Gtf2h1 G A 7: 46,816,944 A472T probably damaging Het
Krt82 T A 15: 101,550,254 D117V probably damaging Het
Mkl2 T A 16: 13,412,318 S956T possibly damaging Het
Mmrn2 G A 14: 34,396,294 probably null Het
Msrb3 T A 10: 120,784,136 S93C possibly damaging Het
Ncl AAAGCCTCCC AAAGCCTCCCAAGCCTCCC 1: 86,350,816 probably benign Het
Olfr228 A G 2: 86,483,640 I34T probably damaging Het
Osbpl10 C T 9: 115,207,553 Q381* probably null Het
Pelp1 A G 11: 70,396,590 L464P probably damaging Het
Pigs A G 11: 78,335,605 D216G probably benign Het
Ptprk T C 10: 28,496,947 probably null Het
Pyroxd1 T C 6: 142,348,644 probably null Het
Ros1 T A 10: 52,046,125 D2284V probably damaging Het
Rptor T C 11: 119,743,891 S178P possibly damaging Het
Slc8a1 C T 17: 81,648,407 D401N probably damaging Het
Tas2r143 T C 6: 42,400,760 Y175H probably benign Het
Tdrd9 T C 12: 112,023,259 S502P probably damaging Het
Tmem38a A G 8: 72,580,103 H142R probably damaging Het
Tmem44 A G 16: 30,514,833 probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Umod A G 7: 119,464,741 V614A possibly damaging Het
Vmn2r5 A T 3: 64,491,305 L751* probably null Het
Wdr37 A T 13: 8,805,840 I489N probably damaging Het
Xdh T C 17: 73,939,836 T78A probably benign Het
Zfp866 A T 8: 69,767,622 probably benign Het
Other mutations in Lrfn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Lrfn5 APN 12 61844126 missense probably benign
IGL02010:Lrfn5 APN 12 61839683 missense probably damaging 0.96
IGL03033:Lrfn5 APN 12 61840047 missense probably damaging 1.00
IGL03094:Lrfn5 APN 12 61839746 missense probably benign 0.00
IGL03207:Lrfn5 APN 12 61843326 missense probably damaging 1.00
falstaffian UTSW 12 61843562 missense probably benign 0.21
PIT4696001:Lrfn5 UTSW 12 61843557 missense probably damaging 1.00
R0402:Lrfn5 UTSW 12 61840017 missense probably benign 0.22
R0738:Lrfn5 UTSW 12 61840592 nonsense probably null
R0744:Lrfn5 UTSW 12 61839668 missense probably damaging 1.00
R0833:Lrfn5 UTSW 12 61839668 missense probably damaging 1.00
R0973:Lrfn5 UTSW 12 61843437 missense probably damaging 1.00
R0973:Lrfn5 UTSW 12 61843437 missense probably damaging 1.00
R0974:Lrfn5 UTSW 12 61843437 missense probably damaging 1.00
R1332:Lrfn5 UTSW 12 61857528 splice site probably benign
R1500:Lrfn5 UTSW 12 61839741 missense probably damaging 1.00
R2039:Lrfn5 UTSW 12 61840323 missense possibly damaging 0.82
R3834:Lrfn5 UTSW 12 61840030 missense probably damaging 1.00
R4171:Lrfn5 UTSW 12 61843382 missense probably damaging 1.00
R4212:Lrfn5 UTSW 12 61843820 missense probably benign
R4394:Lrfn5 UTSW 12 61843490 missense probably damaging 1.00
R4578:Lrfn5 UTSW 12 61843977 missense probably benign
R4661:Lrfn5 UTSW 12 61839647 missense probably damaging 1.00
R4730:Lrfn5 UTSW 12 61840719 missense probably benign 0.03
R4955:Lrfn5 UTSW 12 61839978 missense probably benign 0.29
R4968:Lrfn5 UTSW 12 61839675 missense probably damaging 1.00
R4970:Lrfn5 UTSW 12 61839675 missense probably damaging 1.00
R5078:Lrfn5 UTSW 12 61843874 missense possibly damaging 0.47
R5165:Lrfn5 UTSW 12 61839624 missense possibly damaging 0.89
R5768:Lrfn5 UTSW 12 61839723 missense probably benign 0.44
R5892:Lrfn5 UTSW 12 61843418 missense probably damaging 1.00
R6133:Lrfn5 UTSW 12 61843788 missense probably benign 0.22
R6211:Lrfn5 UTSW 12 61839470 missense probably benign 0.00
R6297:Lrfn5 UTSW 12 61843562 missense probably benign 0.21
R6341:Lrfn5 UTSW 12 61843582 nonsense probably null
R6861:Lrfn5 UTSW 12 61839690 missense probably damaging 1.00
R7179:Lrfn5 UTSW 12 61843982 missense probably benign
R7392:Lrfn5 UTSW 12 61840304 missense probably benign 0.00
R8224:Lrfn5 UTSW 12 61843406 missense not run
Z1177:Lrfn5 UTSW 12 61839817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAATCATATCCATGAGCCTGATCCTG -3'
(R):5'- TGAAACAATGCCATTCAAACTTCTTCCC -3'

Sequencing Primer
(F):5'- TCCACTAAGTCAGGCTCGAATG -3'
(R):5'- AAACTTCTTCCCCACATAGACTTATC -3'
Posted On2013-11-18