Incidental Mutation 'R1073:Tmem44'
ID85551
Institutional Source Beutler Lab
Gene Symbol Tmem44
Ensembl Gene ENSMUSG00000022537
Gene Nametransmembrane protein 44
Synonyms9330161C17Rik, 1700007N03Rik
MMRRC Submission 039159-MU
Accession Numbers

Genbank: NM_172614.3; Ensembl: ENSMUST00000140402

Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R1073 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location30511855-30550842 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 30514833 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089775] [ENSMUST00000140402] [ENSMUST00000144001] [ENSMUST00000149110]
Predicted Effect probably benign
Transcript: ENSMUST00000089775
SMART Domains Protein: ENSMUSP00000087207
Gene: ENSMUSG00000022537

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125559
Predicted Effect probably benign
Transcript: ENSMUST00000140402
SMART Domains Protein: ENSMUSP00000123494
Gene: ENSMUSG00000022537

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 90 112 N/A INTRINSIC
transmembrane domain 133 155 N/A INTRINSIC
transmembrane domain 179 197 N/A INTRINSIC
transmembrane domain 209 231 N/A INTRINSIC
transmembrane domain 246 268 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 383 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144001
SMART Domains Protein: ENSMUSP00000119318
Gene: ENSMUSG00000022537

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144491
Predicted Effect probably benign
Transcript: ENSMUST00000149110
SMART Domains Protein: ENSMUSP00000116531
Gene: ENSMUSG00000022537

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
transmembrane domain 44 65 N/A INTRINSIC
low complexity region 70 84 N/A INTRINSIC
low complexity region 180 192 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.5%
  • 20x: 94.5%
Validation Efficiency 98% (40/41)
Allele List at MGI

All alleles(8) : Targeted, other(3) Gene trapped(5)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap3 T C 4: 136,236,431 I334T probably damaging Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Cacna2d3 T A 14: 29,045,623 H765L probably damaging Het
Cngb1 A G 8: 95,303,567 probably null Het
Csmd1 C T 8: 16,358,463 probably benign Het
Cux1 A T 5: 136,252,541 probably null Het
D7Ertd443e T C 7: 134,270,218 K232R probably damaging Het
Dock6 A G 9: 21,846,518 S97P probably benign Het
Eml5 G A 12: 98,830,973 A1099V probably damaging Het
Gtf2h1 G A 7: 46,816,944 A472T probably damaging Het
Krt82 T A 15: 101,550,254 D117V probably damaging Het
Lrfn5 A G 12: 61,840,809 Y461C probably damaging Het
Mkl2 T A 16: 13,412,318 S956T possibly damaging Het
Mmrn2 G A 14: 34,396,294 probably null Het
Msrb3 T A 10: 120,784,136 S93C possibly damaging Het
Ncl AAAGCCTCCC AAAGCCTCCCAAGCCTCCC 1: 86,350,816 probably benign Het
Olfr228 A G 2: 86,483,640 I34T probably damaging Het
Osbpl10 C T 9: 115,207,553 Q381* probably null Het
Pelp1 A G 11: 70,396,590 L464P probably damaging Het
Pigs A G 11: 78,335,605 D216G probably benign Het
Ptprk T C 10: 28,496,947 probably null Het
Pyroxd1 T C 6: 142,348,644 probably null Het
Ros1 T A 10: 52,046,125 D2284V probably damaging Het
Rptor T C 11: 119,743,891 S178P possibly damaging Het
Slc8a1 C T 17: 81,648,407 D401N probably damaging Het
Tas2r143 T C 6: 42,400,760 Y175H probably benign Het
Tdrd9 T C 12: 112,023,259 S502P probably damaging Het
Tmem38a A G 8: 72,580,103 H142R probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Umod A G 7: 119,464,741 V614A possibly damaging Het
Vmn2r5 A T 3: 64,491,305 L751* probably null Het
Wdr37 A T 13: 8,805,840 I489N probably damaging Het
Xdh T C 17: 73,939,836 T78A probably benign Het
Zfp866 A T 8: 69,767,622 probably benign Het
Other mutations in Tmem44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02226:Tmem44 APN 16 30539381 splice site probably benign
IGL03308:Tmem44 APN 16 30543748 missense probably damaging 0.97
1mM(1):Tmem44 UTSW 16 30543497 unclassified probably benign
R0452:Tmem44 UTSW 16 30517463 splice site probably benign
R1962:Tmem44 UTSW 16 30543401 critical splice donor site probably null
R2118:Tmem44 UTSW 16 30547444 nonsense probably null
R2122:Tmem44 UTSW 16 30547444 nonsense probably null
R2124:Tmem44 UTSW 16 30547444 nonsense probably null
R4870:Tmem44 UTSW 16 30540773 missense probably damaging 1.00
R5328:Tmem44 UTSW 16 30540891 missense possibly damaging 0.83
R6653:Tmem44 UTSW 16 30537551 missense probably damaging 0.97
R6818:Tmem44 UTSW 16 30543221 intron probably null
R7058:Tmem44 UTSW 16 30547395 missense possibly damaging 0.92
R7738:Tmem44 UTSW 16 30543410 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TGACAGACTCCCGACTTTGAGTTCC -3'
(R):5'- AGTGCTACGACATTTGCCTCGC -3'

Sequencing Primer
(F):5'- CGACTTTGAGTTCCGAGCTG -3'
(R):5'- gatccatcccccacaacac -3'
Posted On2013-11-18