Incidental Mutation 'R1074:Zfp512b'
ID85557
Institutional Source Beutler Lab
Gene Symbol Zfp512b
Ensembl Gene ENSMUSG00000000823
Gene Namezinc finger protein 512B
SynonymsLOC269401, Znf512b
MMRRC Submission 039160-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1074 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181582103-181592803 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 181589179 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 374 (S374R)
Ref Sequence ENSEMBL: ENSMUSP00000115601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108789] [ENSMUST00000128553] [ENSMUST00000132714] [ENSMUST00000140103] [ENSMUST00000153998]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108789
AA Change: S364R

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104417
Gene: ENSMUSG00000000823
AA Change: S364R

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
ZnF_C2H2 106 128 5.83e1 SMART
ZnF_C2H2 141 164 3.89e-3 SMART
internal_repeat_1 168 224 4.38e-14 PROSPERO
internal_repeat_1 246 302 4.38e-14 PROSPERO
ZnF_C2H2 487 511 5.68e1 SMART
ZnF_C2H2 517 540 2.91e-2 SMART
low complexity region 547 560 N/A INTRINSIC
ZnF_C2H2 571 593 1.59e1 SMART
ZnF_C2H2 607 630 4.4e-2 SMART
Blast:ZnF_C2H2 727 756 8e-11 BLAST
ZnF_C2H2 761 784 1.45e-2 SMART
low complexity region 808 832 N/A INTRINSIC
low complexity region 838 856 N/A INTRINSIC
low complexity region 858 866 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000128553
AA Change: S374R

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115601
Gene: ENSMUSG00000000823
AA Change: S374R

DomainStartEndE-ValueType
ZnF_C2H2 85 107 5.83e1 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 130 140 N/A INTRINSIC
ZnF_C2H2 151 174 3.89e-3 SMART
internal_repeat_1 178 234 1.6e-14 PROSPERO
internal_repeat_1 256 312 1.6e-14 PROSPERO
ZnF_C2H2 497 521 5.68e1 SMART
ZnF_C2H2 527 550 2.91e-2 SMART
low complexity region 557 570 N/A INTRINSIC
ZnF_C2H2 581 603 1.59e1 SMART
ZnF_C2H2 617 640 4.4e-2 SMART
internal_repeat_2 723 761 4.94e-7 PROSPERO
ZnF_C2H2 771 794 1.45e-2 SMART
low complexity region 818 842 N/A INTRINSIC
low complexity region 848 866 N/A INTRINSIC
low complexity region 868 876 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131866
Predicted Effect probably benign
Transcript: ENSMUST00000132538
SMART Domains Protein: ENSMUSP00000119677
Gene: ENSMUSG00000000823

DomainStartEndE-ValueType
ZnF_C2H2 46 70 5.68e1 SMART
ZnF_C2H2 76 99 2.91e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132714
SMART Domains Protein: ENSMUSP00000117711
Gene: ENSMUSG00000002455

DomainStartEndE-ValueType
Pfam:PRP1_N 1 54 6e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133598
SMART Domains Protein: ENSMUSP00000114378
Gene: ENSMUSG00000000823

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135561
SMART Domains Protein: ENSMUSP00000121721
Gene: ENSMUSG00000000823

DomainStartEndE-ValueType
ZnF_C2H2 12 35 1.45e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136759
Predicted Effect probably benign
Transcript: ENSMUST00000140103
SMART Domains Protein: ENSMUSP00000123579
Gene: ENSMUSG00000000823

DomainStartEndE-ValueType
Blast:ZnF_C2H2 2 24 8e-7 BLAST
ZnF_C2H2 29 52 1.45e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144856
SMART Domains Protein: ENSMUSP00000114982
Gene: ENSMUSG00000089917

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:CPT 83 211 2.7e-10 PFAM
Pfam:PRK 85 253 7.7e-56 PFAM
Pfam:AAA_17 86 240 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152365
Predicted Effect probably benign
Transcript: ENSMUST00000153998
SMART Domains Protein: ENSMUSP00000123096
Gene: ENSMUSG00000000823

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183624
Meta Mutation Damage Score 0.0963 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,226 K958E probably benign Het
Aak1 T C 6: 86,935,439 S98P probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acbd3 C T 1: 180,738,548 Q269* probably null Het
Ankrd6 T C 4: 32,822,232 H179R probably damaging Het
Ano1 T A 7: 144,611,680 N603Y probably damaging Het
Catsperg1 T C 7: 29,206,849 E143G probably damaging Het
Epha5 G T 5: 84,150,395 A383E probably damaging Het
Epha5 C T 5: 84,150,396 A383T probably damaging Het
Epn1 T C 7: 5,095,048 V286A probably benign Het
Fam117b C T 1: 59,958,326 A279V possibly damaging Het
Gm15448 T C 7: 3,823,070 D308G probably damaging Het
Impg2 G A 16: 56,265,178 probably benign Het
Man1a2 C T 3: 100,656,086 R81H possibly damaging Het
Medag G T 5: 149,412,209 V78L probably benign Het
Meioc C T 11: 102,675,393 H612Y probably damaging Het
Nab2 G A 10: 127,663,255 Q385* probably null Het
Ncor1 A G 11: 62,392,551 F437L probably damaging Het
Olfr134 T C 17: 38,175,440 S119P probably damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr796 T C 10: 129,608,466 N5S probably damaging Het
Pcdhga1 A G 18: 37,825,087 probably benign Het
Pik3c2a G A 7: 116,350,925 R1286* probably null Het
Plk3 T C 4: 117,131,758 E268G probably damaging Het
Pzp T A 6: 128,487,924 N1329I probably benign Het
Reps1 A G 10: 18,094,446 T264A probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Srarp T A 4: 141,433,396 D42V probably damaging Het
Srbd1 T A 17: 86,003,952 H679L probably damaging Het
Tbc1d2b G A 9: 90,222,340 P583L possibly damaging Het
Vmn2r22 T C 6: 123,649,258 D73G probably benign Het
Other mutations in Zfp512b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Zfp512b APN 2 181587069 missense probably damaging 0.98
IGL00667:Zfp512b APN 2 181589733 missense probably damaging 0.97
IGL00763:Zfp512b APN 2 181590151 missense probably damaging 1.00
IGL01448:Zfp512b APN 2 181587785 missense possibly damaging 0.62
IGL01788:Zfp512b APN 2 181588763 missense possibly damaging 0.86
IGL02048:Zfp512b APN 2 181589922 missense possibly damaging 0.77
IGL02752:Zfp512b APN 2 181588071 missense possibly damaging 0.46
IGL03238:Zfp512b APN 2 181589760 missense probably damaging 1.00
R0421:Zfp512b UTSW 2 181588258 nonsense probably null
R0507:Zfp512b UTSW 2 181584964 unclassified probably benign
R0713:Zfp512b UTSW 2 181588300 missense possibly damaging 0.79
R1513:Zfp512b UTSW 2 181589189 missense probably benign 0.00
R1560:Zfp512b UTSW 2 181588679 missense probably benign 0.00
R1595:Zfp512b UTSW 2 181588436 missense probably damaging 1.00
R1673:Zfp512b UTSW 2 181588493 missense possibly damaging 0.61
R1845:Zfp512b UTSW 2 181585735 missense probably damaging 1.00
R1888:Zfp512b UTSW 2 181588442 missense probably damaging 0.99
R1888:Zfp512b UTSW 2 181588442 missense probably damaging 0.99
R1943:Zfp512b UTSW 2 181588415 missense probably damaging 1.00
R1975:Zfp512b UTSW 2 181587085 nonsense probably null
R2520:Zfp512b UTSW 2 181589502 missense probably damaging 1.00
R3876:Zfp512b UTSW 2 181588763 frame shift probably null
R3877:Zfp512b UTSW 2 181588763 frame shift probably null
R4171:Zfp512b UTSW 2 181590598 unclassified probably null
R4607:Zfp512b UTSW 2 181588774 missense probably damaging 1.00
R4732:Zfp512b UTSW 2 181588739 missense probably benign
R4733:Zfp512b UTSW 2 181588739 missense probably benign
R4766:Zfp512b UTSW 2 181585095 unclassified probably benign
R4888:Zfp512b UTSW 2 181587063 missense probably damaging 1.00
R4965:Zfp512b UTSW 2 181586338 missense probably damaging 1.00
R5632:Zfp512b UTSW 2 181585668 missense probably benign 0.27
R6897:Zfp512b UTSW 2 181590480 missense probably damaging 1.00
R6970:Zfp512b UTSW 2 181586348 missense possibly damaging 0.92
R7432:Zfp512b UTSW 2 181589856 missense probably benign
R7560:Zfp512b UTSW 2 181587082 missense probably damaging 1.00
R8045:Zfp512b UTSW 2 181584824 makesense probably null
R8321:Zfp512b UTSW 2 181587138 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGCCCAAAGGTCCCTGAGATAGATG -3'
(R):5'- ACACTTCGTGCTACAGGCAAGAAC -3'

Sequencing Primer
(F):5'- CCCTGAGATAGATGGTTGCTCC -3'
(R):5'- AAGGTATGGGAGGTCATTTGAG -3'
Posted On2013-11-18