Incidental Mutation 'R1074:Vmn2r22'
ID85566
Institutional Source Beutler Lab
Gene Symbol Vmn2r22
Ensembl Gene ENSMUSG00000095486
Gene Namevomeronasal 2, receptor 22
SynonymsEG546913
MMRRC Submission 039160-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R1074 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location123609758-123650635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123649258 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 73 (D73G)
Ref Sequence ENSEMBL: ENSMUSP00000132043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170808]
Predicted Effect probably benign
Transcript: ENSMUST00000170808
AA Change: D73G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000132043
Gene: ENSMUSG00000095486
AA Change: D73G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:ANF_receptor 81 473 1.4e-32 PFAM
Pfam:NCD3G 517 570 2.2e-23 PFAM
Pfam:7tm_3 601 838 1.2e-54 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,226 K958E probably benign Het
Aak1 T C 6: 86,935,439 S98P probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acbd3 C T 1: 180,738,548 Q269* probably null Het
Ankrd6 T C 4: 32,822,232 H179R probably damaging Het
Ano1 T A 7: 144,611,680 N603Y probably damaging Het
Catsperg1 T C 7: 29,206,849 E143G probably damaging Het
Epha5 G T 5: 84,150,395 A383E probably damaging Het
Epha5 C T 5: 84,150,396 A383T probably damaging Het
Epn1 T C 7: 5,095,048 V286A probably benign Het
Fam117b C T 1: 59,958,326 A279V possibly damaging Het
Gm15448 T C 7: 3,823,070 D308G probably damaging Het
Impg2 G A 16: 56,265,178 probably benign Het
Man1a2 C T 3: 100,656,086 R81H possibly damaging Het
Medag G T 5: 149,412,209 V78L probably benign Het
Meioc C T 11: 102,675,393 H612Y probably damaging Het
Nab2 G A 10: 127,663,255 Q385* probably null Het
Ncor1 A G 11: 62,392,551 F437L probably damaging Het
Olfr134 T C 17: 38,175,440 S119P probably damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr796 T C 10: 129,608,466 N5S probably damaging Het
Pcdhga1 A G 18: 37,825,087 probably benign Het
Pik3c2a G A 7: 116,350,925 R1286* probably null Het
Plk3 T C 4: 117,131,758 E268G probably damaging Het
Pzp T A 6: 128,487,924 N1329I probably benign Het
Reps1 A G 10: 18,094,446 T264A probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Srarp T A 4: 141,433,396 D42V probably damaging Het
Srbd1 T A 17: 86,003,952 H679L probably damaging Het
Tbc1d2b G A 9: 90,222,340 P583L possibly damaging Het
Zfp512b A T 2: 181,589,179 S374R probably damaging Het
Other mutations in Vmn2r22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Vmn2r22 APN 6 123638053 missense probably damaging 1.00
IGL01764:Vmn2r22 APN 6 123650420 critical splice donor site probably null
IGL02037:Vmn2r22 APN 6 123649067 missense probably damaging 1.00
IGL02183:Vmn2r22 APN 6 123638004 missense probably damaging 1.00
IGL02335:Vmn2r22 APN 6 123638092 missense probably damaging 0.99
IGL02440:Vmn2r22 APN 6 123637405 missense probably benign 0.00
IGL02663:Vmn2r22 APN 6 123649158 missense probably benign 0.11
IGL03101:Vmn2r22 APN 6 123637336 missense probably benign 0.09
R0266:Vmn2r22 UTSW 6 123637404 missense probably damaging 0.99
R0348:Vmn2r22 UTSW 6 123637725 missense probably damaging 1.00
R0780:Vmn2r22 UTSW 6 123637974 missense probably damaging 1.00
R0849:Vmn2r22 UTSW 6 123637404 missense probably damaging 0.99
R1456:Vmn2r22 UTSW 6 123637665 missense possibly damaging 0.86
R1719:Vmn2r22 UTSW 6 123637843 missense possibly damaging 0.68
R1989:Vmn2r22 UTSW 6 123637541 missense probably damaging 1.00
R2928:Vmn2r22 UTSW 6 123637443 missense probably damaging 0.96
R2939:Vmn2r22 UTSW 6 123637635 missense probably damaging 0.99
R3727:Vmn2r22 UTSW 6 123650625 missense possibly damaging 0.70
R3782:Vmn2r22 UTSW 6 123650632 nonsense probably null
R3873:Vmn2r22 UTSW 6 123637380 missense possibly damaging 0.68
R4344:Vmn2r22 UTSW 6 123637797 missense probably damaging 1.00
R4407:Vmn2r22 UTSW 6 123637954 missense probably damaging 1.00
R4428:Vmn2r22 UTSW 6 123637858 missense possibly damaging 0.47
R4430:Vmn2r22 UTSW 6 123637858 missense possibly damaging 0.47
R4431:Vmn2r22 UTSW 6 123637858 missense possibly damaging 0.47
R4701:Vmn2r22 UTSW 6 123650469 missense probably benign 0.00
R5274:Vmn2r22 UTSW 6 123650634 start codon destroyed probably null 0.93
R5668:Vmn2r22 UTSW 6 123637914 missense probably benign 0.06
R5776:Vmn2r22 UTSW 6 123637714 missense probably damaging 1.00
R6416:Vmn2r22 UTSW 6 123637738 missense probably damaging 1.00
R7788:Vmn2r22 UTSW 6 123637600 missense not run
R8208:Vmn2r22 UTSW 6 123637485 missense probably damaging 1.00
R8267:Vmn2r22 UTSW 6 123638041 missense possibly damaging 0.81
R8400:Vmn2r22 UTSW 6 123637527 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAAAACCATAGAACTTTTCATGGCCTT -3'
(R):5'- CACTTTGCAGTTGGGAACAATTTTCCTT -3'

Sequencing Primer
(F):5'- TCATCTCCGTAAAGTCAGCATTG -3'
(R):5'- ttgagaaacagaggcaggtag -3'
Posted On2013-11-18