Incidental Mutation 'R1074:Epn1'
ID85569
Institutional Source Beutler Lab
Gene Symbol Epn1
Ensembl Gene ENSMUSG00000035203
Gene Nameepsin 1
SynonymsIbp1
MMRRC Submission 039160-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1074 (G1)
Quality Score190
Status Validated
Chromosome7
Chromosomal Location5080235-5098178 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5095048 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 286 (V286A)
Ref Sequence ENSEMBL: ENSMUSP00000146638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045277] [ENSMUST00000098845] [ENSMUST00000208634]
Predicted Effect probably benign
Transcript: ENSMUST00000045277
AA Change: V286A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043340
Gene: ENSMUSG00000035203
AA Change: V286A

DomainStartEndE-ValueType
ENTH 18 144 5.84e-65 SMART
low complexity region 157 174 N/A INTRINSIC
UIM 183 202 2.94e-1 SMART
UIM 208 227 4.15e-1 SMART
UIM 233 252 5.48e-1 SMART
low complexity region 279 293 N/A INTRINSIC
low complexity region 294 316 N/A INTRINSIC
low complexity region 332 350 N/A INTRINSIC
low complexity region 363 379 N/A INTRINSIC
low complexity region 454 466 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098845
AA Change: V286A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096445
Gene: ENSMUSG00000035203
AA Change: V286A

DomainStartEndE-ValueType
ENTH 18 144 5.84e-65 SMART
low complexity region 157 174 N/A INTRINSIC
UIM 183 202 2.94e-1 SMART
UIM 208 227 4.15e-1 SMART
UIM 233 252 5.48e-1 SMART
low complexity region 279 293 N/A INTRINSIC
low complexity region 294 316 N/A INTRINSIC
low complexity region 332 350 N/A INTRINSIC
low complexity region 363 379 N/A INTRINSIC
low complexity region 454 466 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155436
Predicted Effect probably benign
Transcript: ENSMUST00000208634
AA Change: V286A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0606 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epsin protein family. The encoded protein binds clathrin and is involved in the endocytosis of clathrin-coated vesicles. Loss of function of this gene is associated with reduced tumor growth and progression in certain cancer types. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities. Mice homozygous null for both Epn1 and Epn2 display defects in angiogenic vascular remodeling, impaired somitogenesis and extensive cell death in the nervous tissue, resulting in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,226 K958E probably benign Het
Aak1 T C 6: 86,935,439 S98P probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acbd3 C T 1: 180,738,548 Q269* probably null Het
Ankrd6 T C 4: 32,822,232 H179R probably damaging Het
Ano1 T A 7: 144,611,680 N603Y probably damaging Het
Catsperg1 T C 7: 29,206,849 E143G probably damaging Het
Epha5 G T 5: 84,150,395 A383E probably damaging Het
Epha5 C T 5: 84,150,396 A383T probably damaging Het
Fam117b C T 1: 59,958,326 A279V possibly damaging Het
Gm15448 T C 7: 3,823,070 D308G probably damaging Het
Impg2 G A 16: 56,265,178 probably benign Het
Man1a2 C T 3: 100,656,086 R81H possibly damaging Het
Medag G T 5: 149,412,209 V78L probably benign Het
Meioc C T 11: 102,675,393 H612Y probably damaging Het
Nab2 G A 10: 127,663,255 Q385* probably null Het
Ncor1 A G 11: 62,392,551 F437L probably damaging Het
Olfr134 T C 17: 38,175,440 S119P probably damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr796 T C 10: 129,608,466 N5S probably damaging Het
Pcdhga1 A G 18: 37,825,087 probably benign Het
Pik3c2a G A 7: 116,350,925 R1286* probably null Het
Plk3 T C 4: 117,131,758 E268G probably damaging Het
Pzp T A 6: 128,487,924 N1329I probably benign Het
Reps1 A G 10: 18,094,446 T264A probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Srarp T A 4: 141,433,396 D42V probably damaging Het
Srbd1 T A 17: 86,003,952 H679L probably damaging Het
Tbc1d2b G A 9: 90,222,340 P583L possibly damaging Het
Vmn2r22 T C 6: 123,649,258 D73G probably benign Het
Zfp512b A T 2: 181,589,179 S374R probably damaging Het
Other mutations in Epn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Epn1 APN 7 5095036 missense probably benign 0.19
IGL03126:Epn1 APN 7 5095685 missense probably benign 0.01
epsilon UTSW 7 5095048 missense probably benign
R1365:Epn1 UTSW 7 5093370 missense probably benign 0.05
R1848:Epn1 UTSW 7 5089998 missense probably damaging 1.00
R2041:Epn1 UTSW 7 5083875 missense probably damaging 0.99
R2237:Epn1 UTSW 7 5097602 missense probably damaging 0.98
R2238:Epn1 UTSW 7 5097602 missense probably damaging 0.98
R2239:Epn1 UTSW 7 5097602 missense probably damaging 0.98
R4255:Epn1 UTSW 7 5097638 missense probably damaging 1.00
R4324:Epn1 UTSW 7 5097211 missense probably benign 0.07
R4542:Epn1 UTSW 7 5093981 missense possibly damaging 0.63
R4703:Epn1 UTSW 7 5095148 missense probably damaging 0.99
R4740:Epn1 UTSW 7 5090013 missense probably damaging 1.00
R4845:Epn1 UTSW 7 5093909 missense possibly damaging 0.94
R5838:Epn1 UTSW 7 5097166 nonsense probably null
R5952:Epn1 UTSW 7 5093912 missense probably damaging 1.00
R6251:Epn1 UTSW 7 5095926 missense probably damaging 1.00
R6251:Epn1 UTSW 7 5095936 missense probably damaging 1.00
R6296:Epn1 UTSW 7 5090123 missense probably damaging 0.98
R6710:Epn1 UTSW 7 5097304 missense probably damaging 0.99
R6937:Epn1 UTSW 7 5089944 missense probably damaging 1.00
R7196:Epn1 UTSW 7 5093381 missense possibly damaging 0.68
R7420:Epn1 UTSW 7 5097688 missense possibly damaging 0.77
R7948:Epn1 UTSW 7 5089993 nonsense probably null
X0065:Epn1 UTSW 7 5095093 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTTTGTCTTCACACAGAGGACCCAG -3'
(R):5'- CTTAGCTTACACAGCCAGATGCCC -3'

Sequencing Primer
(F):5'- CTGGATAGGGACATTGGTAGGC -3'
(R):5'- GGCCTTCCTTCCTAAAGAGATGG -3'
Posted On2013-11-18