Incidental Mutation 'R1074:Ano1'
ID 85572
Institutional Source Beutler Lab
Gene Symbol Ano1
Ensembl Gene ENSMUSG00000031075
Gene Name anoctamin 1, calcium activated chloride channel
Synonyms Tmem16a
MMRRC Submission 039160-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1074 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 144588549-144751974 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 144611680 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 603 (N603Y)
Ref Sequence ENSEMBL: ENSMUSP00000112616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033393] [ENSMUST00000118556] [ENSMUST00000121758]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000033393
AA Change: N542Y

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033393
Gene: ENSMUSG00000031075
AA Change: N542Y

DomainStartEndE-ValueType
low complexity region 129 147 N/A INTRINSIC
Pfam:Anoctamin 320 898 1.3e-149 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118556
AA Change: N600Y

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113899
Gene: ENSMUSG00000031075
AA Change: N600Y

DomainStartEndE-ValueType
Pfam:Anoct_dimer 112 375 5.5e-83 PFAM
Pfam:Anoctamin 378 955 6.7e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121758
AA Change: N603Y

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112616
Gene: ENSMUSG00000031075
AA Change: N603Y

DomainStartEndE-ValueType
Pfam:Anoct_dimer 54 317 7.1e-83 PFAM
Pfam:Anoctamin 320 901 2.2e-139 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208094
Meta Mutation Damage Score 0.5894 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (33/34)
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit postnatal death associated with aerophagia, slow postnatal weight gain, cyanosis, and abnormal tracheal morphology. Mice homozygous for a different knock-out allele exhibit proteinuria and intracellular endosomal vesicles in PTE cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,226 K958E probably benign Het
Aak1 T C 6: 86,935,439 S98P probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acbd3 C T 1: 180,738,548 Q269* probably null Het
Ankrd6 T C 4: 32,822,232 H179R probably damaging Het
Catsperg1 T C 7: 29,206,849 E143G probably damaging Het
Epha5 G T 5: 84,150,395 A383E probably damaging Het
Epha5 C T 5: 84,150,396 A383T probably damaging Het
Epn1 T C 7: 5,095,048 V286A probably benign Het
Fam117b C T 1: 59,958,326 A279V possibly damaging Het
Gm15448 T C 7: 3,823,070 D308G probably damaging Het
Impg2 G A 16: 56,265,178 probably benign Het
Man1a2 C T 3: 100,656,086 R81H possibly damaging Het
Medag G T 5: 149,412,209 V78L probably benign Het
Meioc C T 11: 102,675,393 H612Y probably damaging Het
Nab2 G A 10: 127,663,255 Q385* probably null Het
Ncor1 A G 11: 62,392,551 F437L probably damaging Het
Olfr134 T C 17: 38,175,440 S119P probably damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr796 T C 10: 129,608,466 N5S probably damaging Het
Pcdhga1 A G 18: 37,825,087 probably benign Het
Pik3c2a G A 7: 116,350,925 R1286* probably null Het
Plk3 T C 4: 117,131,758 E268G probably damaging Het
Pzp T A 6: 128,487,924 N1329I probably benign Het
Reps1 A G 10: 18,094,446 T264A probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Srarp T A 4: 141,433,396 D42V probably damaging Het
Srbd1 T A 17: 86,003,952 H679L probably damaging Het
Tbc1d2b G A 9: 90,222,340 P583L possibly damaging Het
Vmn2r22 T C 6: 123,649,258 D73G probably benign Het
Zfp512b A T 2: 181,589,179 S374R probably damaging Het
Other mutations in Ano1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Ano1 APN 7 144638513 missense probably damaging 1.00
IGL00754:Ano1 APN 7 144597231 missense probably damaging 0.98
IGL00780:Ano1 APN 7 144655630 missense probably damaging 0.99
IGL00918:Ano1 APN 7 144644752 splice site probably benign
IGL01112:Ano1 APN 7 144637145 missense possibly damaging 0.52
IGL01285:Ano1 APN 7 144644742 missense probably benign 0.00
IGL01285:Ano1 APN 7 144595538 missense probably damaging 0.98
IGL01308:Ano1 APN 7 144595498 missense probably damaging 0.99
IGL01407:Ano1 APN 7 144637111 missense probably benign 0.22
IGL01672:Ano1 APN 7 144655675 missense probably damaging 0.96
IGL01920:Ano1 APN 7 144611454 splice site probably benign
IGL01926:Ano1 APN 7 144610875 missense possibly damaging 0.94
IGL02164:Ano1 APN 7 144637181 missense possibly damaging 0.91
IGL02190:Ano1 APN 7 144618883 missense probably benign 0.41
IGL02214:Ano1 APN 7 144655708 missense possibly damaging 0.80
IGL02299:Ano1 APN 7 144590075 missense possibly damaging 0.80
IGL02567:Ano1 APN 7 144611625 missense probably damaging 1.00
IGL03131:Ano1 APN 7 144603585 missense possibly damaging 0.90
IGL03291:Ano1 APN 7 144621675 missense probably damaging 1.00
IGL03299:Ano1 APN 7 144654256 missense probably damaging 1.00
IGL03394:Ano1 APN 7 144595439 splice site probably null
PIT4434001:Ano1 UTSW 7 144610895 missense probably benign 0.28
R0502:Ano1 UTSW 7 144597215 missense probably damaging 1.00
R0595:Ano1 UTSW 7 144590153 missense possibly damaging 0.94
R0732:Ano1 UTSW 7 144619488 critical splice acceptor site probably null
R0970:Ano1 UTSW 7 144595571 missense probably benign 0.02
R0988:Ano1 UTSW 7 144633653 missense possibly damaging 0.94
R1301:Ano1 UTSW 7 144633689 missense possibly damaging 0.60
R1528:Ano1 UTSW 7 144595566 missense probably damaging 1.00
R2018:Ano1 UTSW 7 144654250 missense probably damaging 1.00
R2056:Ano1 UTSW 7 144648052 missense probably damaging 1.00
R2057:Ano1 UTSW 7 144648052 missense probably damaging 1.00
R2058:Ano1 UTSW 7 144648052 missense probably damaging 1.00
R2059:Ano1 UTSW 7 144611390 missense probably damaging 1.00
R2860:Ano1 UTSW 7 144590012 missense probably damaging 1.00
R2861:Ano1 UTSW 7 144590012 missense probably damaging 1.00
R3770:Ano1 UTSW 7 144595569 missense probably damaging 1.00
R3970:Ano1 UTSW 7 144607963 missense probably benign 0.00
R4179:Ano1 UTSW 7 144650505 missense probably damaging 1.00
R4489:Ano1 UTSW 7 144611742 missense probably benign 0.00
R4678:Ano1 UTSW 7 144669552 missense probably benign 0.01
R4915:Ano1 UTSW 7 144611375 missense possibly damaging 0.69
R5114:Ano1 UTSW 7 144657083 missense possibly damaging 0.71
R5362:Ano1 UTSW 7 144648600 unclassified probably benign
R5364:Ano1 UTSW 7 144637204 missense probably damaging 1.00
R5366:Ano1 UTSW 7 144654209 missense possibly damaging 0.85
R5387:Ano1 UTSW 7 144648619 missense probably benign
R5762:Ano1 UTSW 7 144648037 missense probably damaging 0.99
R5857:Ano1 UTSW 7 144637103 missense probably benign 0.02
R6091:Ano1 UTSW 7 144669434 missense probably benign 0.12
R6093:Ano1 UTSW 7 144611377 missense possibly damaging 0.72
R6177:Ano1 UTSW 7 144678741 missense possibly damaging 0.79
R6246:Ano1 UTSW 7 144633725 missense possibly damaging 0.82
R6274:Ano1 UTSW 7 144618863 missense probably benign 0.01
R6323:Ano1 UTSW 7 144611686 missense possibly damaging 0.95
R6574:Ano1 UTSW 7 144607916 critical splice donor site probably null
R6782:Ano1 UTSW 7 144621687 missense probably damaging 1.00
R6880:Ano1 UTSW 7 144644742 missense probably benign 0.00
R6909:Ano1 UTSW 7 144655731 missense probably damaging 0.96
R7066:Ano1 UTSW 7 144637086 missense probably benign 0.35
R7073:Ano1 UTSW 7 144638552 missense probably damaging 0.96
R7146:Ano1 UTSW 7 144655656 missense probably benign 0.00
R7420:Ano1 UTSW 7 144655641 missense probably benign 0.00
R7874:Ano1 UTSW 7 144621724 missense probably damaging 1.00
R8468:Ano1 UTSW 7 144655620 missense probably damaging 1.00
R8867:Ano1 UTSW 7 144669660 missense possibly damaging 0.66
R8923:Ano1 UTSW 7 144650551 missense possibly damaging 0.61
R9215:Ano1 UTSW 7 144595605 missense probably damaging 1.00
R9281:Ano1 UTSW 7 144595581 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAACTCCTGTGCTCTGTTGACCC -3'
(R):5'- TCCCACTAAGCATGTCTACGCCTG -3'

Sequencing Primer
(F):5'- TGGAAGCTGCACTTCCTG -3'
(R):5'- ATGTCTACGCCTGCCCTG -3'
Posted On 2013-11-18