Incidental Mutation 'R1074:Meioc'
ID 85580
Institutional Source Beutler Lab
Gene Symbol Meioc
Ensembl Gene ENSMUSG00000051455
Gene Name meiosis specific with coiled-coil domain
Synonyms LOC380729, LOC268491, Gm1564
MMRRC Submission 039160-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R1074 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 102556177-102573066 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 102566219 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 612 (H612Y)
Ref Sequence ENSEMBL: ENSMUSP00000097947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100378] [ENSMUST00000156590]
AlphaFold A2AG06
Predicted Effect probably damaging
Transcript: ENSMUST00000100378
AA Change: H612Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097947
Gene: ENSMUSG00000051455
AA Change: H612Y

DomainStartEndE-ValueType
low complexity region 526 537 N/A INTRINSIC
low complexity region 712 728 N/A INTRINSIC
Pfam:DUF4582 757 922 5.1e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155813
Predicted Effect probably benign
Transcript: ENSMUST00000156590
SMART Domains Protein: ENSMUSP00000116246
Gene: ENSMUSG00000051455

DomainStartEndE-ValueType
low complexity region 470 481 N/A INTRINSIC
Meta Mutation Damage Score 0.1149 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (33/34)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit infertility with small gonads, absent germ cells and arrested meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,912,421 (GRCm39) S98P probably damaging Het
Abcb10 C T 8: 124,688,791 (GRCm39) G495D probably damaging Het
Acbd3 C T 1: 180,566,113 (GRCm39) Q269* probably null Het
Ankrd6 T C 4: 32,822,232 (GRCm39) H179R probably damaging Het
Ano1 T A 7: 144,165,417 (GRCm39) N603Y probably damaging Het
Catsperg1 T C 7: 28,906,274 (GRCm39) E143G probably damaging Het
Epha5 G T 5: 84,298,254 (GRCm39) A383E probably damaging Het
Epha5 C T 5: 84,298,255 (GRCm39) A383T probably damaging Het
Epn1 T C 7: 5,098,047 (GRCm39) V286A probably benign Het
Fam117b C T 1: 59,997,485 (GRCm39) A279V possibly damaging Het
Impg2 G A 16: 56,085,541 (GRCm39) probably benign Het
Man1a2 C T 3: 100,563,402 (GRCm39) R81H possibly damaging Het
Medag G T 5: 149,335,674 (GRCm39) V78L probably benign Het
Nab2 G A 10: 127,499,124 (GRCm39) Q385* probably null Het
Ncor1 A G 11: 62,283,377 (GRCm39) F437L probably damaging Het
Or10p1 T C 10: 129,444,335 (GRCm39) N5S probably damaging Het
Or2n1 T C 17: 38,486,331 (GRCm39) S119P probably damaging Het
Or8g18 G C 9: 39,149,547 (GRCm39) P58A probably benign Het
Pcdhga1 A G 18: 37,958,140 (GRCm39) probably benign Het
Pik3c2a G A 7: 115,950,160 (GRCm39) R1286* probably null Het
Pira13 T C 7: 3,826,069 (GRCm39) D308G probably damaging Het
Plk3 T C 4: 116,988,955 (GRCm39) E268G probably damaging Het
Pzp T A 6: 128,464,887 (GRCm39) N1329I probably benign Het
Reps1 A G 10: 17,970,194 (GRCm39) T264A probably benign Het
Sp110 C G 1: 85,516,839 (GRCm39) E219D probably damaging Het
Spata31e2 T C 1: 26,722,307 (GRCm39) K958E probably benign Het
Srarp T A 4: 141,160,707 (GRCm39) D42V probably damaging Het
Srbd1 T A 17: 86,311,380 (GRCm39) H679L probably damaging Het
Tbc1d2b G A 9: 90,104,393 (GRCm39) P583L possibly damaging Het
Vmn2r22 T C 6: 123,626,217 (GRCm39) D73G probably benign Het
Zfp512b A T 2: 181,230,972 (GRCm39) S374R probably damaging Het
Other mutations in Meioc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Meioc APN 11 102,565,113 (GRCm39) missense probably benign 0.33
IGL01952:Meioc APN 11 102,563,011 (GRCm39) missense possibly damaging 0.79
IGL02006:Meioc APN 11 102,565,092 (GRCm39) missense probably damaging 1.00
IGL02195:Meioc APN 11 102,565,683 (GRCm39) missense possibly damaging 0.91
IGL02339:Meioc APN 11 102,559,274 (GRCm39) missense probably benign 0.18
IGL02935:Meioc APN 11 102,563,017 (GRCm39) missense probably benign 0.06
IGL03294:Meioc APN 11 102,571,495 (GRCm39) missense probably damaging 1.00
PIT4519001:Meioc UTSW 11 102,570,783 (GRCm39) missense probably damaging 1.00
R0285:Meioc UTSW 11 102,563,017 (GRCm39) missense probably benign 0.06
R0964:Meioc UTSW 11 102,570,857 (GRCm39) missense probably damaging 1.00
R2024:Meioc UTSW 11 102,566,184 (GRCm39) missense probably benign 0.00
R4012:Meioc UTSW 11 102,566,654 (GRCm39) missense probably damaging 0.99
R4429:Meioc UTSW 11 102,566,546 (GRCm39) missense probably damaging 1.00
R4491:Meioc UTSW 11 102,565,746 (GRCm39) missense possibly damaging 0.84
R4594:Meioc UTSW 11 102,564,992 (GRCm39) missense probably damaging 1.00
R4752:Meioc UTSW 11 102,565,259 (GRCm39) missense probably benign 0.00
R5301:Meioc UTSW 11 102,570,871 (GRCm39) missense probably damaging 1.00
R5352:Meioc UTSW 11 102,566,139 (GRCm39) missense probably benign 0.03
R5646:Meioc UTSW 11 102,566,083 (GRCm39) missense possibly damaging 0.94
R5958:Meioc UTSW 11 102,565,979 (GRCm39) missense probably benign 0.41
R5968:Meioc UTSW 11 102,566,657 (GRCm39) missense probably damaging 0.99
R6157:Meioc UTSW 11 102,559,227 (GRCm39) missense probably damaging 1.00
R6410:Meioc UTSW 11 102,565,860 (GRCm39) missense probably benign 0.00
R6644:Meioc UTSW 11 102,559,286 (GRCm39) critical splice donor site probably null
R7285:Meioc UTSW 11 102,557,168 (GRCm39) missense probably benign 0.00
R7440:Meioc UTSW 11 102,565,063 (GRCm39) missense possibly damaging 0.67
R7815:Meioc UTSW 11 102,566,414 (GRCm39) missense probably damaging 1.00
R7984:Meioc UTSW 11 102,565,432 (GRCm39) missense possibly damaging 0.94
R8009:Meioc UTSW 11 102,567,569 (GRCm39) missense probably damaging 1.00
R8078:Meioc UTSW 11 102,559,226 (GRCm39) nonsense probably null
R8195:Meioc UTSW 11 102,565,893 (GRCm39) nonsense probably null
R8429:Meioc UTSW 11 102,565,032 (GRCm39) missense probably benign 0.06
R8797:Meioc UTSW 11 102,567,686 (GRCm39) nonsense probably null
R8854:Meioc UTSW 11 102,566,589 (GRCm39) missense probably damaging 0.98
R8891:Meioc UTSW 11 102,559,246 (GRCm39) missense probably benign 0.43
R9081:Meioc UTSW 11 102,565,001 (GRCm39) missense probably benign 0.00
R9360:Meioc UTSW 11 102,565,779 (GRCm39) missense probably benign 0.13
R9539:Meioc UTSW 11 102,565,506 (GRCm39) missense probably damaging 0.99
R9549:Meioc UTSW 11 102,556,550 (GRCm39) intron probably benign
R9751:Meioc UTSW 11 102,566,419 (GRCm39) nonsense probably null
Z1177:Meioc UTSW 11 102,557,190 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGCAGCTTCAAAAGGTTCTAACCACTC -3'
(R):5'- TCCAACAGTGGAACAACTGAATGGC -3'

Sequencing Primer
(F):5'- TCAAAAGGTTCTAACCACTCTTCAG -3'
(R):5'- TCTTAGGGGAAACCCATTTGAACC -3'
Posted On 2013-11-18