Incidental Mutation 'R1074:Impg2'
ID85582
Institutional Source Beutler Lab
Gene Symbol Impg2
Ensembl Gene ENSMUSG00000035270
Gene Nameinterphotoreceptor matrix proteoglycan 2
SynonymsIPM200, Spacrcan, PG10.2
MMRRC Submission 039160-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R1074 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location56204313-56273756 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 56265178 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069936] [ENSMUST00000160116]
Predicted Effect probably benign
Transcript: ENSMUST00000069936
SMART Domains Protein: ENSMUSP00000063648
Gene: ENSMUSG00000035270

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 66 74 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
SEA 235 345 7.7e-29 SMART
low complexity region 396 407 N/A INTRINSIC
low complexity region 419 444 N/A INTRINSIC
SEA 895 1018 2.18e-28 SMART
EGF_like 1016 1054 3.57e1 SMART
EGF_like 1056 1096 3.04e1 SMART
transmembrane domain 1105 1127 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160116
SMART Domains Protein: ENSMUSP00000125135
Gene: ENSMUSG00000035270

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 66 74 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
SEA 235 345 7.7e-29 SMART
SEA 786 909 2.18e-28 SMART
EGF_like 907 945 3.57e1 SMART
EGF_like 947 987 3.04e1 SMART
transmembrane domain 996 1018 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds chondroitin sulfate and hyaluronan and is a proteoglycan. The encoded protein plays a role in the organization of the interphotoreceptor matrix and may promote the growth and maintenance of the light-sensitive photoreceptor outer segment. Defects in this gene are a cause of retinitis pigmentosa type 56 and maculopathy, IMPG2-related.[provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,226 K958E probably benign Het
Aak1 T C 6: 86,935,439 S98P probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acbd3 C T 1: 180,738,548 Q269* probably null Het
Ankrd6 T C 4: 32,822,232 H179R probably damaging Het
Ano1 T A 7: 144,611,680 N603Y probably damaging Het
Catsperg1 T C 7: 29,206,849 E143G probably damaging Het
Epha5 G T 5: 84,150,395 A383E probably damaging Het
Epha5 C T 5: 84,150,396 A383T probably damaging Het
Epn1 T C 7: 5,095,048 V286A probably benign Het
Fam117b C T 1: 59,958,326 A279V possibly damaging Het
Gm15448 T C 7: 3,823,070 D308G probably damaging Het
Man1a2 C T 3: 100,656,086 R81H possibly damaging Het
Medag G T 5: 149,412,209 V78L probably benign Het
Meioc C T 11: 102,675,393 H612Y probably damaging Het
Nab2 G A 10: 127,663,255 Q385* probably null Het
Ncor1 A G 11: 62,392,551 F437L probably damaging Het
Olfr134 T C 17: 38,175,440 S119P probably damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr796 T C 10: 129,608,466 N5S probably damaging Het
Pcdhga1 A G 18: 37,825,087 probably benign Het
Pik3c2a G A 7: 116,350,925 R1286* probably null Het
Plk3 T C 4: 117,131,758 E268G probably damaging Het
Pzp T A 6: 128,487,924 N1329I probably benign Het
Reps1 A G 10: 18,094,446 T264A probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Srarp T A 4: 141,433,396 D42V probably damaging Het
Srbd1 T A 17: 86,003,952 H679L probably damaging Het
Tbc1d2b G A 9: 90,222,340 P583L possibly damaging Het
Vmn2r22 T C 6: 123,649,258 D73G probably benign Het
Zfp512b A T 2: 181,589,179 S374R probably damaging Het
Other mutations in Impg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Impg2 APN 16 56261605 nonsense probably null
IGL01097:Impg2 APN 16 56260647 critical splice donor site probably null
IGL01115:Impg2 APN 16 56259440 missense possibly damaging 0.61
IGL01545:Impg2 APN 16 56225717 splice site probably benign
IGL01644:Impg2 APN 16 56259870 missense probably benign 0.04
IGL01690:Impg2 APN 16 56205205 missense probably damaging 0.97
IGL01781:Impg2 APN 16 56252225 missense probably benign 0.21
IGL01801:Impg2 APN 16 56236748 missense probably damaging 0.97
IGL01980:Impg2 APN 16 56221527 missense probably damaging 0.99
IGL02059:Impg2 APN 16 56259972 missense probably damaging 1.00
IGL02140:Impg2 APN 16 56259468 missense probably benign 0.05
IGL02206:Impg2 APN 16 56259597 missense possibly damaging 0.92
IGL02245:Impg2 APN 16 56269082 missense probably damaging 0.96
IGL02584:Impg2 APN 16 56265011 missense probably damaging 1.00
IGL03061:Impg2 APN 16 56268416 missense probably damaging 1.00
IGL03123:Impg2 APN 16 56267122 missense probably damaging 1.00
IGL03280:Impg2 APN 16 56268268 nonsense probably null
R0051:Impg2 UTSW 16 56258048 missense probably damaging 1.00
R0117:Impg2 UTSW 16 56261642 missense probably damaging 0.99
R0193:Impg2 UTSW 16 56265049 nonsense probably null
R0270:Impg2 UTSW 16 56269015 missense possibly damaging 0.88
R0326:Impg2 UTSW 16 56260485 missense probably damaging 1.00
R0330:Impg2 UTSW 16 56252264 missense probably damaging 0.99
R0812:Impg2 UTSW 16 56257939 intron probably benign
R1283:Impg2 UTSW 16 56257939 intron probably benign
R1618:Impg2 UTSW 16 56259858 missense probably damaging 0.97
R1708:Impg2 UTSW 16 56265078 missense probably benign 0.10
R1713:Impg2 UTSW 16 56260526 missense probably benign 0.25
R1827:Impg2 UTSW 16 56267220 missense possibly damaging 0.62
R1853:Impg2 UTSW 16 56260277 missense probably damaging 1.00
R2064:Impg2 UTSW 16 56243630 critical splice donor site probably null
R2100:Impg2 UTSW 16 56231385 splice site probably null
R2125:Impg2 UTSW 16 56265064 missense probably damaging 1.00
R2128:Impg2 UTSW 16 56218379 missense probably damaging 1.00
R2195:Impg2 UTSW 16 56260134 missense probably benign 0.39
R2247:Impg2 UTSW 16 56268264 missense probably damaging 0.97
R2366:Impg2 UTSW 16 56259873 missense probably benign 0.04
R2411:Impg2 UTSW 16 56252154 missense probably damaging 1.00
R4193:Impg2 UTSW 16 56268411 missense probably benign 0.00
R4356:Impg2 UTSW 16 56260164 missense probably damaging 1.00
R4424:Impg2 UTSW 16 56260025 missense possibly damaging 0.56
R4575:Impg2 UTSW 16 56261732 missense probably damaging 1.00
R4766:Impg2 UTSW 16 56257939 intron probably benign
R5024:Impg2 UTSW 16 56260100 missense probably damaging 0.97
R5278:Impg2 UTSW 16 56221517 missense probably benign 0.06
R5383:Impg2 UTSW 16 56243626 missense probably benign 0.03
R5766:Impg2 UTSW 16 56259820 missense possibly damaging 0.73
R5909:Impg2 UTSW 16 56258136 missense probably damaging 0.99
R6525:Impg2 UTSW 16 56205149 missense probably damaging 1.00
R6684:Impg2 UTSW 16 56259929 missense probably benign 0.33
R6692:Impg2 UTSW 16 56252333 missense probably damaging 1.00
R6711:Impg2 UTSW 16 56265086 missense probably damaging 1.00
R6909:Impg2 UTSW 16 56204584 missense probably damaging 0.97
R6959:Impg2 UTSW 16 56268330 missense probably benign 0.01
R7226:Impg2 UTSW 16 56267104 nonsense probably null
R7456:Impg2 UTSW 16 56259913 missense probably benign 0.03
R7528:Impg2 UTSW 16 56260380 missense possibly damaging 0.86
R7532:Impg2 UTSW 16 56267180 missense probably damaging 0.96
R7601:Impg2 UTSW 16 56260031 missense probably benign 0.22
R7803:Impg2 UTSW 16 56267150 missense probably damaging 0.99
R8063:Impg2 UTSW 16 56261456 intron probably benign
R8251:Impg2 UTSW 16 56259597 missense possibly damaging 0.92
R8292:Impg2 UTSW 16 56260626 missense probably damaging 1.00
X0023:Impg2 UTSW 16 56259876 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGCTTTAGGTGATGAGGCCAACCC -3'
(R):5'- ATGGCGATGATCTCACCACCACTG -3'

Sequencing Primer
(F):5'- GGCCTGTAATGAATTTTCTGAGTG -3'
(R):5'- CTCAGTAGGACACATTCATAGCTTC -3'
Posted On2013-11-18