Incidental Mutation 'R1075:Tbc1d2b'
ID85615
Institutional Source Beutler Lab
Gene Symbol Tbc1d2b
Ensembl Gene ENSMUSG00000037410
Gene NameTBC1 domain family, member 2B
Synonyms1810061M12Rik
MMRRC Submission 039161-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1075 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location90202027-90270804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90222340 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 583 (P583L)
Ref Sequence ENSEMBL: ENSMUSP00000045413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041767]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041767
AA Change: P583L

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000045413
Gene: ENSMUSG00000037410
AA Change: P583L

DomainStartEndE-ValueType
PH 35 141 2.66e-9 SMART
low complexity region 324 334 N/A INTRINSIC
low complexity region 343 356 N/A INTRINSIC
Blast:TBC 358 601 2e-25 BLAST
TBC 661 881 3.75e-60 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120385
Meta Mutation Damage Score 0.1094 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd6 T C 4: 32,822,232 H179R probably damaging Het
Apbb2 G T 5: 66,302,678 P692Q probably damaging Het
Arhgap40 A G 2: 158,549,647 N627D possibly damaging Het
Asns G A 6: 7,676,076 R465* probably null Het
Bdkrb1 G A 12: 105,604,303 V43I probably benign Het
Bod1 T C 11: 31,671,514 D63G possibly damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Csnka2ip T A 16: 64,477,947 K685* probably null Het
Dennd5a A T 7: 109,918,601 D609E probably benign Het
Dhx34 G C 7: 16,218,349 T117S probably benign Het
Dpp4 A T 2: 62,352,286 D550E probably benign Het
Enah C T 1: 181,956,501 R81K unknown Het
Epha5 G T 5: 84,150,395 A383E probably damaging Het
Epha5 C T 5: 84,150,396 A383T probably damaging Het
Etnppl A T 3: 130,629,563 M298L probably benign Het
Fam81a G A 9: 70,110,274 R130* probably null Het
Fbxl3 A C 14: 103,095,403 H46Q probably benign Het
Gal3st1 A G 11: 3,998,509 I239V possibly damaging Het
Gm11127 C T 17: 36,056,146 G335D probably benign Het
Htra4 T C 8: 25,033,596 I318V probably benign Het
Igdcc4 A G 9: 65,131,650 T906A possibly damaging Het
Il7r T C 15: 9,516,457 N86S probably benign Het
Mettl17 A G 14: 51,889,606 N231D probably benign Het
Mki67 T C 7: 135,697,311 D1998G probably benign Het
Myh15 G T 16: 49,120,054 R789L possibly damaging Het
Myh7 A G 14: 54,987,403 V569A probably benign Het
Nell1 A G 7: 50,853,840 I617M probably damaging Het
Nlrp1b C G 11: 71,181,686 E444Q probably benign Het
Olfr124 T A 17: 37,805,769 L208* probably null Het
Olfr1330 T C 4: 118,893,205 S41P probably damaging Het
Olfr1373 T A 11: 52,144,850 I227F possibly damaging Het
Psmd2 T C 16: 20,659,959 S603P probably damaging Het
Slc4a2 T A 5: 24,439,057 I913N possibly damaging Het
Smyd4 T C 11: 75,400,338 Y589H probably damaging Het
Spag17 A G 3: 100,093,676 E1850G probably damaging Het
Srsf11 A T 3: 158,012,790 probably benign Het
Stra6 A T 9: 58,151,404 N488I possibly damaging Het
Supt20 C T 3: 54,706,941 Q160* probably null Het
Uchl1 T A 5: 66,682,465 F117I probably damaging Het
Usf1 T A 1: 171,418,109 N307K probably benign Het
Zfp994 T A 17: 22,200,945 H341L probably damaging Het
Other mutations in Tbc1d2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Tbc1d2b APN 9 90226209 missense probably benign
IGL00791:Tbc1d2b APN 9 90227428 missense probably benign 0.18
IGL01457:Tbc1d2b APN 9 90205091 missense probably damaging 1.00
IGL01535:Tbc1d2b APN 9 90215473 splice site probably benign
IGL02089:Tbc1d2b APN 9 90222359 missense possibly damaging 0.80
IGL02409:Tbc1d2b APN 9 90222352 missense probably benign 0.00
IGL02799:Tbc1d2b APN 9 90223434 splice site probably benign
IGL03198:Tbc1d2b APN 9 90222457 missense probably damaging 1.00
Leone UTSW 9 90207887 missense probably damaging 1.00
panthera UTSW 9 90226248 missense probably benign
pardo UTSW 9 90219144 missense probably benign 0.13
pardus UTSW 9 90219010 nonsense probably null
roar UTSW 9 90218922 nonsense probably null
R0062:Tbc1d2b UTSW 9 90222302 splice site probably benign
R0062:Tbc1d2b UTSW 9 90222302 splice site probably benign
R0671:Tbc1d2b UTSW 9 90222505 splice site probably benign
R0682:Tbc1d2b UTSW 9 90249862 missense probably benign 0.01
R1074:Tbc1d2b UTSW 9 90222340 missense possibly damaging 0.68
R1140:Tbc1d2b UTSW 9 90226376 missense possibly damaging 0.91
R1892:Tbc1d2b UTSW 9 90218943 missense probably damaging 0.98
R4064:Tbc1d2b UTSW 9 90218922 nonsense probably null
R4541:Tbc1d2b UTSW 9 90205169 missense probably damaging 1.00
R4590:Tbc1d2b UTSW 9 90270500 missense possibly damaging 0.81
R4651:Tbc1d2b UTSW 9 90207887 missense probably damaging 1.00
R4652:Tbc1d2b UTSW 9 90207887 missense probably damaging 1.00
R4971:Tbc1d2b UTSW 9 90218870 missense probably benign 0.00
R5086:Tbc1d2b UTSW 9 90227457 missense probably benign
R5131:Tbc1d2b UTSW 9 90209759 missense probably damaging 1.00
R5205:Tbc1d2b UTSW 9 90207810 missense probably damaging 1.00
R5502:Tbc1d2b UTSW 9 90227443 missense probably benign
R5509:Tbc1d2b UTSW 9 90218969 missense probably damaging 1.00
R5534:Tbc1d2b UTSW 9 90227506 missense possibly damaging 0.89
R5729:Tbc1d2b UTSW 9 90207872 missense probably benign 0.22
R5735:Tbc1d2b UTSW 9 90222409 missense possibly damaging 0.71
R5847:Tbc1d2b UTSW 9 90209724 missense probably damaging 1.00
R5928:Tbc1d2b UTSW 9 90219144 missense probably benign 0.13
R6595:Tbc1d2b UTSW 9 90226092 missense probably benign 0.02
R6766:Tbc1d2b UTSW 9 90226209 missense probably benign
R7563:Tbc1d2b UTSW 9 90219010 nonsense probably null
R7563:Tbc1d2b UTSW 9 90226248 missense probably benign
X0066:Tbc1d2b UTSW 9 90218658 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AATGACAACACCTGCTTTGCCATCC -3'
(R):5'- TGTGATGCCTAAGGCTTGCTTTTCC -3'

Sequencing Primer
(F):5'- TGCCATCCTGATAGCACTTG -3'
(R):5'- TGGAGGTAACACCTTGCATTC -3'
Posted On2013-11-18