Incidental Mutation 'R1075:Olfr1373'
ID 85618
Institutional Source Beutler Lab
Gene Symbol Olfr1373
Ensembl Gene ENSMUSG00000062204
Gene Name olfactory receptor 1373
Synonyms MOR256-69_p, GA_x6K02T2QP88-3283154-3284089
MMRRC Submission 039161-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R1075 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 52144593-52145528 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 52144850 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 227 (I227F)
Ref Sequence ENSEMBL: ENSMUSP00000077384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078264]
AlphaFold Q7TQT6
Predicted Effect possibly damaging
Transcript: ENSMUST00000078264
AA Change: I227F

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077384
Gene: ENSMUSG00000062204
AA Change: I227F

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 4.7e-46 PFAM
Pfam:7tm_1 41 289 1.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181262
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd6 T C 4: 32,822,232 H179R probably damaging Het
Apbb2 G T 5: 66,302,678 P692Q probably damaging Het
Arhgap40 A G 2: 158,549,647 N627D possibly damaging Het
Asns G A 6: 7,676,076 R465* probably null Het
Bdkrb1 G A 12: 105,604,303 V43I probably benign Het
Bod1 T C 11: 31,671,514 D63G possibly damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Csnka2ip T A 16: 64,477,947 K685* probably null Het
Dennd5a A T 7: 109,918,601 D609E probably benign Het
Dhx34 G C 7: 16,218,349 T117S probably benign Het
Dpp4 A T 2: 62,352,286 D550E probably benign Het
Enah C T 1: 181,956,501 R81K unknown Het
Epha5 G T 5: 84,150,395 A383E probably damaging Het
Epha5 C T 5: 84,150,396 A383T probably damaging Het
Etnppl A T 3: 130,629,563 M298L probably benign Het
Fam81a G A 9: 70,110,274 R130* probably null Het
Fbxl3 A C 14: 103,095,403 H46Q probably benign Het
Gal3st1 A G 11: 3,998,509 I239V possibly damaging Het
Gm11127 C T 17: 36,056,146 G335D probably benign Het
Htra4 T C 8: 25,033,596 I318V probably benign Het
Igdcc4 A G 9: 65,131,650 T906A possibly damaging Het
Il7r T C 15: 9,516,457 N86S probably benign Het
Mettl17 A G 14: 51,889,606 N231D probably benign Het
Mki67 T C 7: 135,697,311 D1998G probably benign Het
Myh15 G T 16: 49,120,054 R789L possibly damaging Het
Myh7 A G 14: 54,987,403 V569A probably benign Het
Nell1 A G 7: 50,853,840 I617M probably damaging Het
Nlrp1b C G 11: 71,181,686 E444Q probably benign Het
Olfr124 T A 17: 37,805,769 L208* probably null Het
Olfr1330 T C 4: 118,893,205 S41P probably damaging Het
Psmd2 T C 16: 20,659,959 S603P probably damaging Het
Slc4a2 T A 5: 24,439,057 I913N possibly damaging Het
Smyd4 T C 11: 75,400,338 Y589H probably damaging Het
Spag17 A G 3: 100,093,676 E1850G probably damaging Het
Srsf11 A T 3: 158,012,790 probably benign Het
Stra6 A T 9: 58,151,404 N488I possibly damaging Het
Supt20 C T 3: 54,706,941 Q160* probably null Het
Tbc1d2b G A 9: 90,222,340 P583L possibly damaging Het
Uchl1 T A 5: 66,682,465 F117I probably damaging Het
Usf1 T A 1: 171,418,109 N307K probably benign Het
Zfp994 T A 17: 22,200,945 H341L probably damaging Het
Other mutations in Olfr1373
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02277:Olfr1373 APN 11 52145362 missense probably damaging 0.97
IGL02814:Olfr1373 APN 11 52144810 missense probably damaging 1.00
R0490:Olfr1373 UTSW 11 52144666 missense probably damaging 1.00
R4050:Olfr1373 UTSW 11 52145134 missense probably damaging 1.00
R5666:Olfr1373 UTSW 11 52144698 nonsense probably null
R6267:Olfr1373 UTSW 11 52144596 missense probably benign 0.28
R6296:Olfr1373 UTSW 11 52144596 missense probably benign 0.28
R6720:Olfr1373 UTSW 11 52144693 missense probably benign 0.18
R6887:Olfr1373 UTSW 11 52145352 missense probably benign 0.01
R8797:Olfr1373 UTSW 11 52145513 missense probably benign 0.05
V1662:Olfr1373 UTSW 11 52145177 missense probably damaging 1.00
X0066:Olfr1373 UTSW 11 52145264 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGTGATGAATCAATGCTTTTGCCACC -3'
(R):5'- TCTGTGAGCTACCTGTTCTCCTGAAG -3'

Sequencing Primer
(F):5'- agtaatggaattagcaaaaagtggg -3'
(R):5'- ACCTGTTCTCCTGAAGATGGC -3'
Posted On 2013-11-18