Incidental Mutation 'R1076:Ankrd50'
ID85637
Institutional Source Beutler Lab
Gene Symbol Ankrd50
Ensembl Gene ENSMUSG00000044864
Gene Nameankyrin repeat domain 50
SynonymsE430012K20Rik
MMRRC Submission 039162-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.672) question?
Stock #R1076 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location38449259-38484844 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38454922 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 176 (N176D)
Ref Sequence ENSEMBL: ENSMUSP00000091858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094300] [ENSMUST00000120875] [ENSMUST00000156038]
Predicted Effect probably damaging
Transcript: ENSMUST00000094300
AA Change: N176D

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091858
Gene: ENSMUSG00000044864
AA Change: N176D

DomainStartEndE-ValueType
ANK 18 47 1.16e-5 SMART
ANK 51 80 3.41e-3 SMART
ANK 84 113 2.9e-6 SMART
ANK 117 147 3.31e-1 SMART
low complexity region 216 243 N/A INTRINSIC
low complexity region 262 282 N/A INTRINSIC
low complexity region 301 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120875
SMART Domains Protein: ENSMUSP00000113349
Gene: ENSMUSG00000044864

DomainStartEndE-ValueType
SCOP:d1kaga_ 72 90 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156038
AA Change: N1099D

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000122842
Gene: ENSMUSG00000044864
AA Change: N1099D

DomainStartEndE-ValueType
Blast:ANK 440 472 8e-11 BLAST
ANK 507 536 7.95e-4 SMART
ANK 540 569 1.01e-5 SMART
ANK 573 602 6.81e-3 SMART
ANK 606 635 1.7e-3 SMART
ANK 639 668 7.64e-6 SMART
ANK 672 706 4.5e-3 SMART
ANK 710 739 3.33e-6 SMART
ANK 743 772 5.37e-1 SMART
ANK 776 806 1.65e-1 SMART
ANK 809 838 1.2e-3 SMART
ANK 842 871 3.97e-4 SMART
ANK 875 904 3.06e-5 SMART
ANK 908 937 2.88e-1 SMART
ANK 941 970 1.16e-5 SMART
ANK 974 1003 3.41e-3 SMART
ANK 1007 1036 2.9e-6 SMART
ANK 1040 1070 3.31e-1 SMART
low complexity region 1139 1166 N/A INTRINSIC
low complexity region 1185 1205 N/A INTRINSIC
low complexity region 1224 1255 N/A INTRINSIC
Meta Mutation Damage Score 0.0686 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ang4 T C 14: 51,764,302 K63R probably damaging Het
Apbb1 A T 7: 105,573,855 L183Q probably benign Het
BC049730 A G 7: 24,713,742 K162R probably benign Het
Cdh17 T C 4: 11,795,581 V387A probably benign Het
Cldn4 A G 5: 134,946,337 S137P probably damaging Het
Cnn1 A T 9: 22,107,869 Q157L probably damaging Het
Csn1s1 A T 5: 87,676,383 probably null Het
Dennd3 C T 15: 73,540,733 H415Y probably damaging Het
Dnpep A G 1: 75,315,938 probably benign Het
Dram1 C A 10: 88,325,384 V208L probably damaging Het
Elovl2 A G 13: 41,190,107 V115A possibly damaging Het
Fryl C T 5: 73,124,673 probably benign Het
Gsap A G 5: 21,287,694 T707A possibly damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ktn1 T A 14: 47,694,638 M674K probably damaging Het
Larp4 A G 15: 99,997,430 T295A probably benign Het
Lrp1 T C 10: 127,563,797 probably benign Het
Macf1 T C 4: 123,385,598 D3870G probably damaging Het
Mctp2 T G 7: 72,185,867 probably null Het
Nbn A T 4: 15,970,719 probably null Het
Neb A G 2: 52,204,892 Y4883H probably damaging Het
Nsun6 A T 2: 15,009,472 C286S probably benign Het
Pabpc4 T A 4: 123,292,908 D307E possibly damaging Het
Pik3cg G A 12: 32,195,714 probably benign Het
Ptpdc1 C T 13: 48,586,810 E382K probably damaging Het
Serpina3k A G 12: 104,340,994 T162A probably benign Het
Sis T C 3: 72,934,098 T795A probably damaging Het
Skint8 T A 4: 111,927,219 V14E probably damaging Het
Slc2a1 T G 4: 119,134,448 M351R probably damaging Het
Slc41a3 G A 6: 90,644,160 C394Y probably benign Het
Srp54b T C 12: 55,255,528 probably benign Het
Ulk2 G A 11: 61,819,309 H358Y probably damaging Het
Utp20 A G 10: 88,772,459 M1572T probably benign Het
Utp20 A T 10: 88,772,543 I1544N possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Other mutations in Ankrd50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Ankrd50 APN 3 38452414 utr 3 prime probably benign
PIT4378001:Ankrd50 UTSW 3 38455263 missense possibly damaging 0.94
PIT4434001:Ankrd50 UTSW 3 38455263 missense possibly damaging 0.94
PIT4651001:Ankrd50 UTSW 3 38455810 nonsense probably null
R0048:Ankrd50 UTSW 3 38483049 missense probably benign 0.00
R0048:Ankrd50 UTSW 3 38483049 missense probably benign 0.00
R0127:Ankrd50 UTSW 3 38456235 missense probably benign 0.00
R0179:Ankrd50 UTSW 3 38455314 missense possibly damaging 0.61
R0417:Ankrd50 UTSW 3 38456361 missense probably damaging 1.00
R0593:Ankrd50 UTSW 3 38483007 nonsense probably null
R1127:Ankrd50 UTSW 3 38457187 missense probably benign 0.02
R1169:Ankrd50 UTSW 3 38454252 missense probably damaging 1.00
R1212:Ankrd50 UTSW 3 38455687 missense probably damaging 1.00
R1447:Ankrd50 UTSW 3 38455542 missense probably damaging 1.00
R1864:Ankrd50 UTSW 3 38454461 missense probably benign 0.02
R1900:Ankrd50 UTSW 3 38455387 missense probably damaging 1.00
R1907:Ankrd50 UTSW 3 38454052 missense probably damaging 1.00
R1912:Ankrd50 UTSW 3 38456776 missense probably benign 0.07
R2051:Ankrd50 UTSW 3 38454493 missense probably benign 0.21
R2197:Ankrd50 UTSW 3 38455592 missense probably damaging 1.00
R2403:Ankrd50 UTSW 3 38483085 nonsense probably null
R3716:Ankrd50 UTSW 3 38454150 missense probably damaging 0.99
R3944:Ankrd50 UTSW 3 38452496 missense probably benign 0.03
R3948:Ankrd50 UTSW 3 38482841 missense possibly damaging 0.75
R4483:Ankrd50 UTSW 3 38457531 missense probably damaging 1.00
R4577:Ankrd50 UTSW 3 38455941 missense probably damaging 0.98
R4691:Ankrd50 UTSW 3 38483010 missense probably benign 0.01
R4907:Ankrd50 UTSW 3 38454973 nonsense probably null
R4907:Ankrd50 UTSW 3 38456675 missense probably damaging 0.98
R5135:Ankrd50 UTSW 3 38455803 missense probably damaging 1.00
R5356:Ankrd50 UTSW 3 38456185 missense probably damaging 0.99
R5368:Ankrd50 UTSW 3 38455050 missense probably damaging 1.00
R5534:Ankrd50 UTSW 3 38456082 missense probably damaging 0.99
R6103:Ankrd50 UTSW 3 38454429 missense probably damaging 0.99
R6169:Ankrd50 UTSW 3 38455839 missense probably damaging 1.00
R6653:Ankrd50 UTSW 3 38457361 missense probably damaging 1.00
R7317:Ankrd50 UTSW 3 38483183 missense possibly damaging 0.90
R7469:Ankrd50 UTSW 3 38454193 missense probably damaging 0.99
R7617:Ankrd50 UTSW 3 38484682 unclassified probably benign
R7749:Ankrd50 UTSW 3 38482721 missense probably damaging 1.00
Z1088:Ankrd50 UTSW 3 38457165 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGCTATGGAAACTGTCAATGGGCAC -3'
(R):5'- ATGCCGACCAATTTGGACGCAC -3'

Sequencing Primer
(F):5'- TCAATGGGCACCGTCTGAG -3'
(R):5'- TTGGACGCACTGCCATGAG -3'
Posted On2013-11-18