Incidental Mutation 'R1076:Srp54b'
ID85661
Institutional Source Beutler Lab
Gene Symbol Srp54b
Ensembl Gene ENSMUSG00000112449
Gene Namesignal recognition particle 54B
Synonyms
MMRRC Submission 039162-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R1076 (G1)
Quality Score184
Status Validated
Chromosome12
Chromosomal Location55155104-55189573 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 55255528 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164243] [ENSMUST00000218879]
Predicted Effect probably benign
Transcript: ENSMUST00000164243
SMART Domains Protein: ENSMUSP00000132835
Gene: ENSMUSG00000079108

DomainStartEndE-ValueType
SRP54_N 2 87 7.47e-19 SMART
AAA 100 277 2.15e-7 SMART
SRP54 101 296 7.25e-90 SMART
Pfam:SRP_SPB 326 431 9.2e-33 PFAM
low complexity region 490 504 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218879
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ang4 T C 14: 51,764,302 K63R probably damaging Het
Ankrd50 T C 3: 38,454,922 N176D probably damaging Het
Apbb1 A T 7: 105,573,855 L183Q probably benign Het
BC049730 A G 7: 24,713,742 K162R probably benign Het
Cdh17 T C 4: 11,795,581 V387A probably benign Het
Cldn4 A G 5: 134,946,337 S137P probably damaging Het
Cnn1 A T 9: 22,107,869 Q157L probably damaging Het
Csn1s1 A T 5: 87,676,383 probably null Het
Dennd3 C T 15: 73,540,733 H415Y probably damaging Het
Dnpep A G 1: 75,315,938 probably benign Het
Dram1 C A 10: 88,325,384 V208L probably damaging Het
Elovl2 A G 13: 41,190,107 V115A possibly damaging Het
Fryl C T 5: 73,124,673 probably benign Het
Gsap A G 5: 21,287,694 T707A possibly damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ktn1 T A 14: 47,694,638 M674K probably damaging Het
Larp4 A G 15: 99,997,430 T295A probably benign Het
Lrp1 T C 10: 127,563,797 probably benign Het
Macf1 T C 4: 123,385,598 D3870G probably damaging Het
Mctp2 T G 7: 72,185,867 probably null Het
Nbn A T 4: 15,970,719 probably null Het
Neb A G 2: 52,204,892 Y4883H probably damaging Het
Nsun6 A T 2: 15,009,472 C286S probably benign Het
Pabpc4 T A 4: 123,292,908 D307E possibly damaging Het
Pik3cg G A 12: 32,195,714 probably benign Het
Ptpdc1 C T 13: 48,586,810 E382K probably damaging Het
Serpina3k A G 12: 104,340,994 T162A probably benign Het
Sis T C 3: 72,934,098 T795A probably damaging Het
Skint8 T A 4: 111,927,219 V14E probably damaging Het
Slc2a1 T G 4: 119,134,448 M351R probably damaging Het
Slc41a3 G A 6: 90,644,160 C394Y probably benign Het
Ulk2 G A 11: 61,819,309 H358Y probably damaging Het
Utp20 A G 10: 88,772,459 M1572T probably benign Het
Utp20 A T 10: 88,772,543 I1544N possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Other mutations in Srp54b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Srp54b APN 12 55252775 missense probably benign 0.39
R0101:Srp54b UTSW 12 55255620 splice site probably benign
R0395:Srp54b UTSW 12 55250099 missense probably damaging 1.00
R1186:Srp54b UTSW 12 55255528 splice site probably benign
R1520:Srp54b UTSW 12 55257569 missense possibly damaging 0.68
R1541:Srp54b UTSW 12 55256059 missense probably benign 0.27
R1732:Srp54b UTSW 12 55252759 splice site probably null
R1836:Srp54b UTSW 12 55250160 splice site probably null
R5344:Srp54b UTSW 12 55255581 missense probably damaging 1.00
R5841:Srp54b UTSW 12 55252829 missense probably benign 0.01
R6269:Srp54b UTSW 12 55255972 missense possibly damaging 0.94
R6417:Srp54b UTSW 12 55250070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCATTGTGTCATCTCTCCTAGCA -3'
(R):5'- GCTAATAAGGCAGTTGGCTCTCCTG -3'

Sequencing Primer
(F):5'- attgtgtcatctctcctagcACTAAG -3'
(R):5'- CCTGATGCTTTGCAGTGTATTAAAC -3'
Posted On2013-11-18