Incidental Mutation 'R1076:Ang4'
ID85666
Institutional Source Beutler Lab
Gene Symbol Ang4
Ensembl Gene ENSMUSG00000060615
Gene Nameangiogenin, ribonuclease A family, member 4
SynonymsRnase5d
MMRRC Submission 039162-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R1076 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location51763878-51773590 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51764302 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 63 (K63R)
Ref Sequence ENSEMBL: ENSMUSP00000073525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073860]
PDB Structure
Biological and Structural Features of Murine Angiogenin-4, an Angiogenic Protein [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000073860
AA Change: K63R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073525
Gene: ENSMUSG00000060615
AA Change: K63R

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
RNAse_Pc 25 141 5.34e-61 SMART
Meta Mutation Damage Score 0.7327 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd50 T C 3: 38,454,922 N176D probably damaging Het
Apbb1 A T 7: 105,573,855 L183Q probably benign Het
BC049730 A G 7: 24,713,742 K162R probably benign Het
Cdh17 T C 4: 11,795,581 V387A probably benign Het
Cldn4 A G 5: 134,946,337 S137P probably damaging Het
Cnn1 A T 9: 22,107,869 Q157L probably damaging Het
Csn1s1 A T 5: 87,676,383 probably null Het
Dennd3 C T 15: 73,540,733 H415Y probably damaging Het
Dnpep A G 1: 75,315,938 probably benign Het
Dram1 C A 10: 88,325,384 V208L probably damaging Het
Elovl2 A G 13: 41,190,107 V115A possibly damaging Het
Fryl C T 5: 73,124,673 probably benign Het
Gsap A G 5: 21,287,694 T707A possibly damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ktn1 T A 14: 47,694,638 M674K probably damaging Het
Larp4 A G 15: 99,997,430 T295A probably benign Het
Lrp1 T C 10: 127,563,797 probably benign Het
Macf1 T C 4: 123,385,598 D3870G probably damaging Het
Mctp2 T G 7: 72,185,867 probably null Het
Nbn A T 4: 15,970,719 probably null Het
Neb A G 2: 52,204,892 Y4883H probably damaging Het
Nsun6 A T 2: 15,009,472 C286S probably benign Het
Pabpc4 T A 4: 123,292,908 D307E possibly damaging Het
Pik3cg G A 12: 32,195,714 probably benign Het
Ptpdc1 C T 13: 48,586,810 E382K probably damaging Het
Serpina3k A G 12: 104,340,994 T162A probably benign Het
Sis T C 3: 72,934,098 T795A probably damaging Het
Skint8 T A 4: 111,927,219 V14E probably damaging Het
Slc2a1 T G 4: 119,134,448 M351R probably damaging Het
Slc41a3 G A 6: 90,644,160 C394Y probably benign Het
Srp54b T C 12: 55,255,528 probably benign Het
Ulk2 G A 11: 61,819,309 H358Y probably damaging Het
Utp20 A G 10: 88,772,459 M1572T probably benign Het
Utp20 A T 10: 88,772,543 I1544N possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Other mutations in Ang4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Ang4 APN 14 51764179 missense probably benign 0.11
IGL01393:Ang4 APN 14 51764213 missense probably benign 0.00
IGL02023:Ang4 APN 14 51764054 utr 3 prime probably benign
IGL02645:Ang4 APN 14 51764347 missense probably damaging 1.00
R0023:Ang4 UTSW 14 51764403 nonsense probably null
R0834:Ang4 UTSW 14 51764268 missense probably benign
R2258:Ang4 UTSW 14 51764498 start gained probably benign
R4524:Ang4 UTSW 14 51764148 nonsense probably null
R4981:Ang4 UTSW 14 51764372 missense probably benign 0.11
R5929:Ang4 UTSW 14 51764251 missense probably damaging 1.00
R7840:Ang4 UTSW 14 51764072 missense probably damaging 1.00
Z1176:Ang4 UTSW 14 51764148 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCCCTGGGATACAGCAAGAAGAG -3'
(R):5'- TTGGCAGGAATCACTGTTGGAAGAG -3'

Sequencing Primer
(F):5'- CTGGGAACTAGTGATCTTCCAGAC -3'
(R):5'- GACAATGAGCCCATGTCCTTTG -3'
Posted On2013-11-18