Incidental Mutation 'R1076:Dennd3'
ID85667
Institutional Source Beutler Lab
Gene Symbol Dennd3
Ensembl Gene ENSMUSG00000036661
Gene NameDENN/MADD domain containing 3
SynonymsE030003N15Rik
MMRRC Submission 039162-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R1076 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location73512560-73572242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 73540733 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 415 (H415Y)
Ref Sequence ENSEMBL: ENSMUSP00000134002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043414] [ENSMUST00000173292]
Predicted Effect probably damaging
Transcript: ENSMUST00000043414
AA Change: H415Y

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046774
Gene: ENSMUSG00000036661
AA Change: H415Y

DomainStartEndE-ValueType
Blast:uDENN 12 161 3e-78 BLAST
DENN 187 373 1.54e-62 SMART
dDENN 436 499 6.81e-14 SMART
WD40 1015 1054 3.68e1 SMART
WD40 1057 1098 3.32e-5 SMART
WD40 1232 1272 1.1e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162488
SMART Domains Protein: ENSMUSP00000125657
Gene: ENSMUSG00000036661

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Blast:DENN 33 104 5e-28 BLAST
DENN 116 302 1.54e-62 SMART
dDENN 312 376 5.63e-6 SMART
WD40 892 931 3.68e1 SMART
WD40 934 975 3.32e-5 SMART
WD40 1109 1149 1.1e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173292
AA Change: H415Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134002
Gene: ENSMUSG00000036661
AA Change: H415Y

DomainStartEndE-ValueType
Blast:uDENN 12 161 2e-78 BLAST
DENN 187 373 1.54e-62 SMART
dDENN 436 499 6.81e-14 SMART
WD40 1015 1054 3.68e1 SMART
WD40 1057 1098 3.32e-5 SMART
Meta Mutation Damage Score 0.2295 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ang4 T C 14: 51,764,302 K63R probably damaging Het
Ankrd50 T C 3: 38,454,922 N176D probably damaging Het
Apbb1 A T 7: 105,573,855 L183Q probably benign Het
BC049730 A G 7: 24,713,742 K162R probably benign Het
Cdh17 T C 4: 11,795,581 V387A probably benign Het
Cldn4 A G 5: 134,946,337 S137P probably damaging Het
Cnn1 A T 9: 22,107,869 Q157L probably damaging Het
Csn1s1 A T 5: 87,676,383 probably null Het
Dnpep A G 1: 75,315,938 probably benign Het
Dram1 C A 10: 88,325,384 V208L probably damaging Het
Elovl2 A G 13: 41,190,107 V115A possibly damaging Het
Fryl C T 5: 73,124,673 probably benign Het
Gsap A G 5: 21,287,694 T707A possibly damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ktn1 T A 14: 47,694,638 M674K probably damaging Het
Larp4 A G 15: 99,997,430 T295A probably benign Het
Lrp1 T C 10: 127,563,797 probably benign Het
Macf1 T C 4: 123,385,598 D3870G probably damaging Het
Mctp2 T G 7: 72,185,867 probably null Het
Nbn A T 4: 15,970,719 probably null Het
Neb A G 2: 52,204,892 Y4883H probably damaging Het
Nsun6 A T 2: 15,009,472 C286S probably benign Het
Pabpc4 T A 4: 123,292,908 D307E possibly damaging Het
Pik3cg G A 12: 32,195,714 probably benign Het
Ptpdc1 C T 13: 48,586,810 E382K probably damaging Het
Serpina3k A G 12: 104,340,994 T162A probably benign Het
Sis T C 3: 72,934,098 T795A probably damaging Het
Skint8 T A 4: 111,927,219 V14E probably damaging Het
Slc2a1 T G 4: 119,134,448 M351R probably damaging Het
Slc41a3 G A 6: 90,644,160 C394Y probably benign Het
Srp54b T C 12: 55,255,528 probably benign Het
Ulk2 G A 11: 61,819,309 H358Y probably damaging Het
Utp20 A G 10: 88,772,459 M1572T probably benign Het
Utp20 A T 10: 88,772,543 I1544N possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Other mutations in Dennd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dennd3 APN 15 73567133 missense probably benign 0.26
IGL00579:Dennd3 APN 15 73540842 missense possibly damaging 0.63
IGL02101:Dennd3 APN 15 73527945 missense possibly damaging 0.81
IGL02164:Dennd3 APN 15 73544448 missense probably benign 0.26
IGL02389:Dennd3 APN 15 73567056 missense probably damaging 1.00
IGL02604:Dennd3 APN 15 73556403 missense probably damaging 1.00
IGL02697:Dennd3 APN 15 73524236 missense possibly damaging 0.82
IGL02885:Dennd3 APN 15 73568696 missense probably benign
IGL03356:Dennd3 APN 15 73568633 missense probably benign 0.19
IGL03388:Dennd3 APN 15 73544359 missense probably damaging 0.98
R0118:Dennd3 UTSW 15 73565076 missense probably damaging 1.00
R0925:Dennd3 UTSW 15 73533435 missense probably damaging 1.00
R1355:Dennd3 UTSW 15 73540854 splice site probably benign
R1370:Dennd3 UTSW 15 73540854 splice site probably benign
R1480:Dennd3 UTSW 15 73532846 missense probably benign 0.20
R1727:Dennd3 UTSW 15 73565128 missense possibly damaging 0.95
R1732:Dennd3 UTSW 15 73537418 splice site probably benign
R1771:Dennd3 UTSW 15 73555101 missense possibly damaging 0.71
R1776:Dennd3 UTSW 15 73555101 missense possibly damaging 0.71
R1779:Dennd3 UTSW 15 73522508 critical splice donor site probably null
R1838:Dennd3 UTSW 15 73565100 missense probably damaging 1.00
R2146:Dennd3 UTSW 15 73523496 missense probably damaging 1.00
R2146:Dennd3 UTSW 15 73555060 missense probably benign 0.35
R2147:Dennd3 UTSW 15 73523487 missense probably damaging 1.00
R2148:Dennd3 UTSW 15 73555060 missense probably benign 0.35
R2149:Dennd3 UTSW 15 73555060 missense probably benign 0.35
R2150:Dennd3 UTSW 15 73555060 missense probably benign 0.35
R2174:Dennd3 UTSW 15 73555305 missense probably damaging 1.00
R2295:Dennd3 UTSW 15 73523555 critical splice donor site probably null
R2905:Dennd3 UTSW 15 73557646 missense probably damaging 1.00
R3106:Dennd3 UTSW 15 73565124 nonsense probably null
R3757:Dennd3 UTSW 15 73522234 missense probably benign 0.00
R3785:Dennd3 UTSW 15 73547577 missense possibly damaging 0.89
R3786:Dennd3 UTSW 15 73547577 missense possibly damaging 0.89
R3787:Dennd3 UTSW 15 73547577 missense possibly damaging 0.89
R3847:Dennd3 UTSW 15 73542732 missense possibly damaging 0.64
R4369:Dennd3 UTSW 15 73540809 missense probably damaging 0.98
R4601:Dennd3 UTSW 15 73567160 missense probably damaging 0.99
R4666:Dennd3 UTSW 15 73570860 missense probably damaging 1.00
R4680:Dennd3 UTSW 15 73533376 missense possibly damaging 0.82
R4708:Dennd3 UTSW 15 73523495 missense probably damaging 1.00
R4789:Dennd3 UTSW 15 73522282 missense probably damaging 1.00
R4920:Dennd3 UTSW 15 73540725 missense probably benign 0.13
R5043:Dennd3 UTSW 15 73527936 missense probably benign 0.00
R5074:Dennd3 UTSW 15 73547295 missense probably damaging 1.00
R5410:Dennd3 UTSW 15 73547448 missense probably benign 0.02
R5421:Dennd3 UTSW 15 73567115 missense probably benign
R5560:Dennd3 UTSW 15 73532895 missense probably damaging 1.00
R6008:Dennd3 UTSW 15 73567080 missense possibly damaging 0.88
R6357:Dennd3 UTSW 15 73556472 missense possibly damaging 0.49
R6563:Dennd3 UTSW 15 73544380 missense probably damaging 0.98
R6687:Dennd3 UTSW 15 73556366 missense possibly damaging 0.64
R6837:Dennd3 UTSW 15 73557693 missense probably damaging 1.00
R6910:Dennd3 UTSW 15 73555116 missense probably benign 0.01
R7125:Dennd3 UTSW 15 73533291 missense possibly damaging 0.50
R7297:Dennd3 UTSW 15 73557610 missense probably damaging 1.00
R7524:Dennd3 UTSW 15 73524246 nonsense probably null
R7580:Dennd3 UTSW 15 73556447 missense possibly damaging 0.89
R7653:Dennd3 UTSW 15 73562426 missense probably damaging 0.99
R7731:Dennd3 UTSW 15 73562367 missense probably damaging 0.99
R7767:Dennd3 UTSW 15 73522230 missense probably benign
R7806:Dennd3 UTSW 15 73570775 missense possibly damaging 0.87
R7860:Dennd3 UTSW 15 73540808 missense probably damaging 0.97
R7943:Dennd3 UTSW 15 73540808 missense probably damaging 0.97
RF006:Dennd3 UTSW 15 73547592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAGCCCTGACACAGAAATG -3'
(R):5'- GGAAATGAACTCAGTAGCCACTCCC -3'

Sequencing Primer
(F):5'- GCCCTGACACAGAAATGTCTTG -3'
(R):5'- CTTGCAGTTGAGAGTCTGCT -3'
Posted On2013-11-18