Incidental Mutation 'R1077:Tfap2b'
ID85670
Institutional Source Beutler Lab
Gene Symbol Tfap2b
Ensembl Gene ENSMUSG00000025927
Gene Nametranscription factor AP-2 beta
SynonymsAP-2(beta), Tcfap2b, E130018K07Rik
MMRRC Submission 039163-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1077 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location19208914-19238576 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 19234149 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 394 (C394*)
Ref Sequence ENSEMBL: ENSMUSP00000140213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027059] [ENSMUST00000064976] [ENSMUST00000187754]
Predicted Effect probably null
Transcript: ENSMUST00000027059
AA Change: C394*
SMART Domains Protein: ENSMUSP00000027059
Gene: ENSMUSG00000025927
AA Change: C394*

DomainStartEndE-ValueType
low complexity region 61 83 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
low complexity region 196 210 N/A INTRINSIC
Pfam:TF_AP-2 228 428 7.1e-94 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000064976
AA Change: C376*
SMART Domains Protein: ENSMUSP00000064488
Gene: ENSMUSG00000025927
AA Change: C376*

DomainStartEndE-ValueType
low complexity region 43 65 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
low complexity region 178 192 N/A INTRINSIC
Pfam:TF_AP-2 208 415 2.2e-100 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000187754
AA Change: C394*
SMART Domains Protein: ENSMUSP00000140213
Gene: ENSMUSG00000025927
AA Change: C394*

DomainStartEndE-ValueType
low complexity region 61 83 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
low complexity region 196 210 N/A INTRINSIC
Pfam:TF_AP-2 226 433 2.2e-101 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AP-2 family of transcription factors. AP-2 proteins form homo- or hetero-dimers with other AP-2 family members and bind specific DNA sequences. They are thought to stimulate cell proliferation and suppress terminal differentiation of specific cell types during embryonic development. Specific AP-2 family members differ in their expression patterns and binding affinity for different promoters. This protein functions as both a transcriptional activator and repressor. Mutations in this gene result in autosomal dominant Char syndrome, suggesting that this gene functions in the differentiation of neural crest cell derivatives. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes have kidney cysts and show neonatal or postnatal lethality, depending on strain background. On a congenic 129P2 background, mice have tremors, polydactyly, defective tubular secretory function and ion homeostasis, hypocalcemia, hyperphosphatemia, hyperuremia, and terminal renal failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik T C 9: 114,301,702 noncoding transcript Het
Apob A G 12: 8,006,017 K1500E probably benign Het
Atp8b1 A T 18: 64,573,262 Y225* probably null Het
Cdc25c A T 18: 34,748,973 probably benign Het
Ceacam15 T C 7: 16,672,075 N184D probably benign Het
Cntln T C 4: 84,996,479 S508P probably damaging Het
Dhx34 A G 7: 16,218,368 S111P probably damaging Het
Dst A G 1: 34,164,167 E759G probably damaging Het
Fis1 G A 5: 136,965,146 A28T probably damaging Het
Fsd1 T C 17: 55,990,542 probably null Het
Gm15293 T A 8: 21,202,433 F90Y probably benign Het
Grk6 T C 13: 55,454,527 probably null Het
Il23r A T 6: 67,473,810 H228Q probably benign Het
Kcnh4 C T 11: 100,752,338 V368I possibly damaging Het
Kdr T C 5: 75,956,231 E728G probably damaging Het
Krt33a T A 11: 100,015,937 M71L probably benign Het
Lrrc7 T G 3: 158,161,143 D987A probably damaging Het
Naalad2 C T 9: 18,347,506 R491Q probably damaging Het
Nedd4l A T 18: 65,167,499 probably benign Het
Pramel7 A G 2: 87,491,190 L167S probably damaging Het
Prkci A G 3: 31,050,192 D568G probably damaging Het
Psg18 G A 7: 18,351,075 T32I possibly damaging Het
Ric8b T A 10: 84,970,717 probably benign Het
Rnf213 T C 11: 119,485,998 probably benign Het
Rttn T C 18: 89,064,249 V1433A probably damaging Het
Sbf2 A T 7: 110,367,172 probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sfta2 T C 17: 35,650,127 probably benign Het
Slc17a1 T A 13: 23,878,450 probably benign Het
Slc6a21 G A 7: 45,288,202 C314Y probably benign Het
Smpd4 T C 16: 17,623,969 V35A probably damaging Het
Sorl1 T C 9: 42,014,490 D1182G probably damaging Het
Syne2 A G 12: 76,042,035 I5056V possibly damaging Het
Tex14 T C 11: 87,519,745 probably benign Het
Tex44 A G 1: 86,427,055 T229A probably benign Het
Ttk T A 9: 83,844,149 probably benign Het
Vmn2r26 G A 6: 124,053,913 V536I probably benign Het
Wac A G 18: 7,921,916 T553A probably damaging Het
Wdcp T A 12: 4,850,685 H180Q probably damaging Het
Wdr33 A G 18: 31,835,461 H235R probably benign Het
Other mutations in Tfap2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Tfap2b APN 1 19214026 missense possibly damaging 0.94
IGL01868:Tfap2b APN 1 19214282 missense probably damaging 0.98
IGL02408:Tfap2b APN 1 19234261 missense probably damaging 0.99
IGL02412:Tfap2b APN 1 19219203 missense probably damaging 0.99
R0243:Tfap2b UTSW 1 19234123 missense probably damaging 1.00
R0552:Tfap2b UTSW 1 19234225 missense probably damaging 1.00
R1541:Tfap2b UTSW 1 19234070 missense probably damaging 1.00
R1816:Tfap2b UTSW 1 19209212 missense probably damaging 0.98
R2474:Tfap2b UTSW 1 19214375 missense possibly damaging 0.49
R5019:Tfap2b UTSW 1 19226442 missense probably benign 0.31
R5300:Tfap2b UTSW 1 19228453 missense probably damaging 1.00
R5331:Tfap2b UTSW 1 19226498 missense probably benign
R5383:Tfap2b UTSW 1 19226498 missense probably benign
R5541:Tfap2b UTSW 1 19214026 missense possibly damaging 0.94
R5744:Tfap2b UTSW 1 19219221 missense probably benign 0.15
R7239:Tfap2b UTSW 1 19234180 missense probably damaging 1.00
R7684:Tfap2b UTSW 1 19214287 missense probably damaging 1.00
R7686:Tfap2b UTSW 1 19214287 missense probably damaging 1.00
R7775:Tfap2b UTSW 1 19234307 missense probably damaging 0.98
R7778:Tfap2b UTSW 1 19234307 missense probably damaging 0.98
R7824:Tfap2b UTSW 1 19234307 missense probably damaging 0.98
X0026:Tfap2b UTSW 1 19226550 missense probably damaging 1.00
Z1176:Tfap2b UTSW 1 19234133 missense not run
Predicted Primers PCR Primer
(F):5'- TTTTCTAGGCGAGCGACCAGAAC -3'
(R):5'- TTCGTGCGTCTCAGTCAACCAG -3'

Sequencing Primer
(F):5'- ACCAGAACTCTGAGGGTGC -3'
(R):5'- TCGGTGAGATAGTTCTGCAG -3'
Posted On2013-11-18