Incidental Mutation 'R1077:Prkci'
ID85675
Institutional Source Beutler Lab
Gene Symbol Prkci
Ensembl Gene ENSMUSG00000037643
Gene Nameprotein kinase C, iota
SynonymsPkci, 2310021H13Rik, Prkcl, aPKClambda, PKClambda, Pkcl
MMRRC Submission 039163-MU
Accession Numbers

Genbank: NM_008857

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1077 (G1)
Quality Score210
Status Validated
Chromosome3
Chromosomal Location30995747-31052959 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31050192 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 568 (D568G)
Ref Sequence ENSEMBL: ENSMUSP00000103884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108249]
PDB Structure
Structure of PKC in Complex with a Substrate Peptide from Par-3 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000108249
AA Change: D568G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103884
Gene: ENSMUSG00000037643
AA Change: D568G

DomainStartEndE-ValueType
PB1 25 106 7.62e-26 SMART
C1 141 190 3.7e-14 SMART
S_TKc 253 521 4.29e-96 SMART
S_TK_X 522 585 3.6e-20 SMART
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein kinase C (PKC) family of serine/threonine protein kinases. The PKC family comprises at least eight members, which are differentially expressed and are involved in a wide variety of cellular processes. This protein kinase is calcium-independent and phospholipid-dependent. It is not activated by phorbolesters or diacylglycerol. This kinase can be recruited to vesicle tubular clusters (VTCs) by direct interaction with the small GTPase RAB2, where this kinase phosphorylates glyceraldehyde-3-phosphate dehydrogenase (GAPD/GAPDH) and plays a role in microtubule dynamics in the early secretory pathway. This kinase is found to be necessary for BCL-ABL-mediated resistance to drug-induced apoptosis and therefore protects leukemia cells against drug-induced apoptosis. There is a single exon pseudogene mapped on chromosome X. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete embryonic lethality. Muscle-specific deletion of this gene impairs glucose transport and induces metabolic and diabetic syndromes. Podocyte-specific deletion leads to altered podocyte architecture, proteinuria, and accelerated renal failure. [provided by MGI curators]
Allele List at MGI

 All alleles(111) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(107)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik T C 9: 114,301,702 noncoding transcript Het
Apob A G 12: 8,006,017 K1500E probably benign Het
Atp8b1 A T 18: 64,573,262 Y225* probably null Het
Cdc25c A T 18: 34,748,973 probably benign Het
Ceacam15 T C 7: 16,672,075 N184D probably benign Het
Cntln T C 4: 84,996,479 S508P probably damaging Het
Dhx34 A G 7: 16,218,368 S111P probably damaging Het
Dst A G 1: 34,164,167 E759G probably damaging Het
Fis1 G A 5: 136,965,146 A28T probably damaging Het
Fsd1 T C 17: 55,990,542 probably null Het
Gm15293 T A 8: 21,202,433 F90Y probably benign Het
Grk6 T C 13: 55,454,527 probably null Het
Il23r A T 6: 67,473,810 H228Q probably benign Het
Kcnh4 C T 11: 100,752,338 V368I possibly damaging Het
Kdr T C 5: 75,956,231 E728G probably damaging Het
Krt33a T A 11: 100,015,937 M71L probably benign Het
Lrrc7 T G 3: 158,161,143 D987A probably damaging Het
Naalad2 C T 9: 18,347,506 R491Q probably damaging Het
Nedd4l A T 18: 65,167,499 probably benign Het
Pramel7 A G 2: 87,491,190 L167S probably damaging Het
Psg18 G A 7: 18,351,075 T32I possibly damaging Het
Ric8b T A 10: 84,970,717 probably benign Het
Rnf213 T C 11: 119,485,998 probably benign Het
Rttn T C 18: 89,064,249 V1433A probably damaging Het
Sbf2 A T 7: 110,367,172 probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sfta2 T C 17: 35,650,127 probably benign Het
Slc17a1 T A 13: 23,878,450 probably benign Het
Slc6a21 G A 7: 45,288,202 C314Y probably benign Het
Smpd4 T C 16: 17,623,969 V35A probably damaging Het
Sorl1 T C 9: 42,014,490 D1182G probably damaging Het
Syne2 A G 12: 76,042,035 I5056V possibly damaging Het
Tex14 T C 11: 87,519,745 probably benign Het
Tex44 A G 1: 86,427,055 T229A probably benign Het
Tfap2b T A 1: 19,234,149 C394* probably null Het
Ttk T A 9: 83,844,149 probably benign Het
Vmn2r26 G A 6: 124,053,913 V536I probably benign Het
Wac A G 18: 7,921,916 T553A probably damaging Het
Wdcp T A 12: 4,850,685 H180Q probably damaging Het
Wdr33 A G 18: 31,835,461 H235R probably benign Het
Other mutations in Prkci
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Prkci APN 3 31034499 missense probably benign 0.13
IGL01472:Prkci APN 3 31050192 missense probably damaging 0.99
3-1:Prkci UTSW 3 31039070 missense probably damaging 0.97
R0584:Prkci UTSW 3 31025140 nonsense probably null
R0699:Prkci UTSW 3 31050273 missense possibly damaging 0.94
R1483:Prkci UTSW 3 31043792 missense probably damaging 1.00
R1815:Prkci UTSW 3 31038495 missense probably damaging 1.00
R2325:Prkci UTSW 3 31031068 intron probably null
R4997:Prkci UTSW 3 31031226 critical splice donor site probably null
R5973:Prkci UTSW 3 31038456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCTCAGTCTGATTCTGGACCC -3'
(R):5'- CAACAGGATACCGAGAGCGACTTC -3'

Sequencing Primer
(F):5'- CTGGACCCTCTCGGTTATAAGG -3'
(R):5'- AGACACACTCTTCTGCAGAC -3'
Posted On2013-11-18