Mutagenetix > Incidental Mutations

Incidental Mutation 'R1077:Lrrc7'

85676

Institutional Source

Beutler Lab

Gene Symbol

Lrrc7

Ensembl Gene

ENSMUSG00000028176

Gene Name

leucine rich repeat containing 7

Synonyms

densin

MMRRC Submission

039163-MU

Accession Numbers

Genbank: NM_001081358; MGI: 2676665

Is this an essential gene?

Probably essential (E-score: 0.783) question?

Stock #

R1077 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

158082891-158562221 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 158161143 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 987 (D987A)

Ref Sequence

ENSEMBL: ENSMUSP00000142498 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106044] [ENSMUST00000199890] [ENSMUST00000200137]

Predicted Effect

probably damaging
Transcript: ENSMUST00000106044
AA Change: D987A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000101659
Gene: ENSMUSG00000028176
AA Change: D987A

Domain	Start	End	E-Value	Type
LRR	53	73	3.65e0	SMART
LRR	96	118	2.2e1	SMART
LRR	142	164	4.21e1	SMART
LRR	165	187	7.36e0	SMART
LRR	188	210	7.05e-1	SMART
LRR	211	233	3.09e1	SMART
LRR	234	257	4.21e1	SMART
LRR	258	279	2.61e2	SMART
LRR	280	303	3.52e-1	SMART
LRR	326	349	1.99e0	SMART
LRR	372	394	2.63e0	SMART
low complexity region	466	476	N/A	INTRINSIC
low complexity region	692	705	N/A	INTRINSIC
Blast:PDZ	708	736	1e-5	BLAST
low complexity region	787	797	N/A	INTRINSIC
low complexity region	864	878	N/A	INTRINSIC
Blast:PDZ	1349	1378	2e-11	BLAST
PDZ	1460	1540	1.33e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000199890
AA Change: D987A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000142440
Gene: ENSMUSG00000028176
AA Change: D987A

Domain	Start	End	E-Value	Type
LRR	53	73	3.65e0	SMART
LRR	96	118	2.2e1	SMART
LRR	142	164	4.21e1	SMART
LRR	165	187	7.36e0	SMART
LRR	188	210	7.05e-1	SMART
LRR	211	233	3.09e1	SMART
LRR	234	257	4.21e1	SMART
LRR	258	279	2.61e2	SMART
LRR	280	303	3.52e-1	SMART
LRR	326	349	1.99e0	SMART
LRR	372	394	2.63e0	SMART
low complexity region	466	476	N/A	INTRINSIC
low complexity region	692	705	N/A	INTRINSIC
Blast:PDZ	708	736	9e-6	BLAST
low complexity region	787	797	N/A	INTRINSIC
low complexity region	864	878	N/A	INTRINSIC
Blast:PDZ	1328	1364	1e-15	BLAST
low complexity region	1374	1387	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000200137
AA Change: D987A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000142498
Gene: ENSMUSG00000028176
AA Change: D987A

Domain	Start	End	E-Value	Type
LRR	52	69	7.6e-1	SMART
LRR	73	92	4.2e-1	SMART
LRR	96	115	3.4e-1	SMART
LRR	142	164	1.8e-1	SMART
LRR	165	184	1.5e-1	SMART
LRR	188	207	2e-2	SMART
LRR	211	233	1.3e-1	SMART
LRR	234	257	1.7e-1	SMART
LRR	257	276	1e0	SMART
LRR	280	299	3.1e-2	SMART
LRR	303	322	6.6e-1	SMART
LRR	326	345	2.1e-1	SMART
LRR	372	391	1.2e-1	SMART
low complexity region	466	476	N/A	INTRINSIC
low complexity region	692	705	N/A	INTRINSIC
Blast:PDZ	708	736	1e-5	BLAST
low complexity region	787	797	N/A	INTRINSIC
low complexity region	864	878	N/A	INTRINSIC
Blast:PDZ	1302	1331	2e-11	BLAST
PDZ	1413	1493	6.4e-22	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000200196
AA Change: D975A

Meta Mutation Damage Score

0.0755

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.3%
20x: 94.6%

Validation Efficiency

100% (40/40)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit limb grasping, reduced long term depression, increased anxiety, increased aggression towards other mice, impaired spatial memory, decreased prepulse inhibition, decreased nesting building behavior, and abnormal dendritic spines. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921528I07Rik	T	C	9: 114,301,702		noncoding transcript	Het
Apob	A	G	12: 8,006,017	K1500E	probably benign	Het
Atp8b1	A	T	18: 64,573,262	Y225*	probably null	Het
Cdc25c	A	T	18: 34,748,973		probably benign	Het
Ceacam15	T	C	7: 16,672,075	N184D	probably benign	Het
Cntln	T	C	4: 84,996,479	S508P	probably damaging	Het
Dhx34	A	G	7: 16,218,368	S111P	probably damaging	Het
Dst	A	G	1: 34,164,167	E759G	probably damaging	Het
Fis1	G	A	5: 136,965,146	A28T	probably damaging	Het
Fsd1	T	C	17: 55,990,542		probably null	Het
Gm15293	T	A	8: 21,202,433	F90Y	probably benign	Het
Grk6	T	C	13: 55,454,527		probably null	Het
Il23r	A	T	6: 67,473,810	H228Q	probably benign	Het
Kcnh4	C	T	11: 100,752,338	V368I	possibly damaging	Het
Kdr	T	C	5: 75,956,231	E728G	probably damaging	Het
Krt33a	T	A	11: 100,015,937	M71L	probably benign	Het
Naalad2	C	T	9: 18,347,506	R491Q	probably damaging	Het
Nedd4l	A	T	18: 65,167,499		probably benign	Het
Pramel7	A	G	2: 87,491,190	L167S	probably damaging	Het
Prkci	A	G	3: 31,050,192	D568G	probably damaging	Het
Psg18	G	A	7: 18,351,075	T32I	possibly damaging	Het
Ric8b	T	A	10: 84,970,717		probably benign	Het
Rnf213	T	C	11: 119,485,998		probably benign	Het
Rttn	T	C	18: 89,064,249	V1433A	probably damaging	Het
Sbf2	A	T	7: 110,367,172		probably benign	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Sfta2	T	C	17: 35,650,127		probably benign	Het
Slc17a1	T	A	13: 23,878,450		probably benign	Het
Slc6a21	G	A	7: 45,288,202	C314Y	probably benign	Het
Smpd4	T	C	16: 17,623,969	V35A	probably damaging	Het
Sorl1	T	C	9: 42,014,490	D1182G	probably damaging	Het
Syne2	A	G	12: 76,042,035	I5056V	possibly damaging	Het
Tex14	T	C	11: 87,519,745		probably benign	Het
Tex44	A	G	1: 86,427,055	T229A	probably benign	Het
Tfap2b	T	A	1: 19,234,149	C394*	probably null	Het
Ttk	T	A	9: 83,844,149		probably benign	Het
Vmn2r26	G	A	6: 124,053,913	V536I	probably benign	Het
Wac	A	G	18: 7,921,916	T553A	probably damaging	Het
Wdcp	T	A	12: 4,850,685	H180Q	probably damaging	Het
Wdr33	A	G	18: 31,835,461	H235R	probably benign	Het

Other mutations in Lrrc7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00594:Lrrc7	APN	3	158187010	missense	probably benign	0.07
IGL00644:Lrrc7	APN	3	158202368	nonsense	probably null
IGL00822:Lrrc7	APN	3	158185474	missense	probably damaging	0.99
IGL00927:Lrrc7	APN	3	158161090	missense	possibly damaging	0.94
IGL00946:Lrrc7	APN	3	158161356	missense	probably benign	0.07
IGL00948:Lrrc7	APN	3	158161557	missense	probably damaging	1.00
IGL01838:Lrrc7	APN	3	158185463	missense	probably damaging	1.00
IGL01874:Lrrc7	APN	3	158240443	splice site	probably benign
IGL02514:Lrrc7	APN	3	158160292	missense	probably damaging	0.96
IGL02545:Lrrc7	APN	3	158185374	splice site	probably benign
IGL02665:Lrrc7	APN	3	158161105	missense	probably damaging	0.99
IGL03129:Lrrc7	APN	3	158161059	missense	probably benign	0.02
N/A:Lrrc7	UTSW	3	158160340	missense	probably benign
R0021:Lrrc7	UTSW	3	158160661	missense	probably damaging	1.00
R0041:Lrrc7	UTSW	3	158164260	splice site	probably benign
R0255:Lrrc7	UTSW	3	158160838	nonsense	probably null
R0278:Lrrc7	UTSW	3	158179795	missense	possibly damaging	0.96
R0409:Lrrc7	UTSW	3	158161426	missense	possibly damaging	0.59
R0612:Lrrc7	UTSW	3	158164353	missense	probably damaging	0.98
R0866:Lrrc7	UTSW	3	158164266	splice site	probably benign
R1103:Lrrc7	UTSW	3	158148706	splice site	probably benign
R1157:Lrrc7	UTSW	3	158160255	missense	probably damaging	1.00
R1187:Lrrc7	UTSW	3	158160402	missense	probably damaging	1.00
R1301:Lrrc7	UTSW	3	158135331	missense	probably benign	0.20
R1433:Lrrc7	UTSW	3	158177306	missense	probably damaging	1.00
R1450:Lrrc7	UTSW	3	158187044	missense	possibly damaging	0.62
R1595:Lrrc7	UTSW	3	158177277	nonsense	probably null
R1659:Lrrc7	UTSW	3	158161408	missense	probably damaging	1.00
R1693:Lrrc7	UTSW	3	158084533	missense	possibly damaging	0.95
R1774:Lrrc7	UTSW	3	158160292	missense	possibly damaging	0.88
R2273:Lrrc7	UTSW	3	158187059	missense	probably damaging	1.00
R2276:Lrrc7	UTSW	3	158179792	missense	probably damaging	1.00
R2302:Lrrc7	UTSW	3	158135244	missense	probably damaging	0.99
R2326:Lrrc7	UTSW	3	158170661	missense	probably damaging	1.00
R2371:Lrrc7	UTSW	3	158161060	missense	probably damaging	0.99
R2383:Lrrc7	UTSW	3	158163956	missense	probably benign
R2679:Lrrc7	UTSW	3	158175108	nonsense	probably null
R2698:Lrrc7	UTSW	3	158135391	missense	probably benign	0.22
R2858:Lrrc7	UTSW	3	158161725	missense	probably damaging	0.99
R3758:Lrrc7	UTSW	3	158163965	missense	probably damaging	1.00
R3791:Lrrc7	UTSW	3	158163956	missense	probably benign
R3805:Lrrc7	UTSW	3	158185493	missense	probably benign	0.10
R3806:Lrrc7	UTSW	3	158185493	missense	probably benign	0.10
R3807:Lrrc7	UTSW	3	158185493	missense	probably benign	0.10
R3892:Lrrc7	UTSW	3	158160696	missense	probably benign	0.08
R3912:Lrrc7	UTSW	3	158291952	missense	probably damaging	1.00
R3913:Lrrc7	UTSW	3	158291952	missense	probably damaging	1.00
R3963:Lrrc7	UTSW	3	158160405	missense	probably damaging	1.00
R4665:Lrrc7	UTSW	3	158318408	critical splice donor site	probably benign
R4666:Lrrc7	UTSW	3	158318408	critical splice donor site	probably benign
R4671:Lrrc7	UTSW	3	158202495	critical splice acceptor site	probably null
R4688:Lrrc7	UTSW	3	158148605	missense	probably damaging	1.00
R4725:Lrrc7	UTSW	3	158318408	critical splice donor site	probably benign
R4726:Lrrc7	UTSW	3	158318408	critical splice donor site	probably benign
R4728:Lrrc7	UTSW	3	158318408	critical splice donor site	probably benign
R4783:Lrrc7	UTSW	3	158127213	critical splice donor site	probably null
R4867:Lrrc7	UTSW	3	158161005	missense	probably damaging	1.00
R4907:Lrrc7	UTSW	3	158161240	missense	probably damaging	1.00
R5032:Lrrc7	UTSW	3	158181580	missense	possibly damaging	0.85
R5107:Lrrc7	UTSW	3	158161896	missense	probably damaging	1.00
R5295:Lrrc7	UTSW	3	158170739	missense	probably damaging	1.00
R5348:Lrrc7	UTSW	3	158175326	missense	probably benign	0.02
R5468:Lrrc7	UTSW	3	158318436	missense	probably damaging	1.00
R5778:Lrrc7	UTSW	3	158170743	missense	probably damaging	1.00
R5897:Lrrc7	UTSW	3	158164353	missense	probably damaging	0.98
R6179:Lrrc7	UTSW	3	158353432	missense	probably damaging	0.99
R6312:Lrrc7	UTSW	3	158160609	missense	probably benign	0.04
R6313:Lrrc7	UTSW	3	158160736	missense	probably damaging	1.00
R6366:Lrrc7	UTSW	3	158135375	missense	probably benign	0.04
R6389:Lrrc7	UTSW	3	158185426	missense	probably damaging	1.00
R6638:Lrrc7	UTSW	3	158135303	missense	probably benign	0.20
R6956:Lrrc7	UTSW	3	158289031	missense	probably benign	0.02
R6969:Lrrc7	UTSW	3	158156913	missense	probably benign	0.19
R7073:Lrrc7	UTSW	3	158127247	missense	probably damaging	1.00
R7313:Lrrc7	UTSW	3	158160474	missense	probably damaging	1.00
R7365:Lrrc7	UTSW	3	158198161	missense	probably damaging	1.00
R7398:Lrrc7	UTSW	3	158291958	nonsense	probably null
R7403:Lrrc7	UTSW	3	158148674	nonsense	probably null
R7407:Lrrc7	UTSW	3	158135241	missense	probably damaging	1.00
R7427:Lrrc7	UTSW	3	158198141	missense	probably benign	0.06
R7453:Lrrc7	UTSW	3	158185409	missense	probably benign	0.00
R7461:Lrrc7	UTSW	3	158187020	missense	probably benign	0.00
R7807:Lrrc7	UTSW	3	158160487	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTCACTGACCCTTCTGAACATGG -3'
(R):5'- TGCCGCCCAGATTCGTCTAAAG -3'

Sequencing Primer
(F):5'- TGGCGAACTGAGCATTCAC -3'
(R):5'- CCAGATTCGTCTAAAGGTGTTATCG -3'

Posted On

2013-11-18