Mutagenetix > Incidental Mutations

Incidental Mutation 'R1077:Cntln'

85677

Institutional Source

Beutler Lab

Gene Symbol

Cntln

Ensembl Gene

ENSMUSG00000038070

Gene Name

centlein, centrosomal protein

Synonyms

B430108F07Rik, D530005L17Rik

MMRRC Submission

039163-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.320) question?

Stock #

R1077 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84884309-85131921 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84996479 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 508 (S508P)

Ref Sequence

ENSEMBL: ENSMUSP00000130491 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000169371]

Predicted Effect

probably damaging
Transcript: ENSMUST00000047023
AA Change: S508P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: S508P

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.25e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.25e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	973	1114	N/A	INTRINSIC
low complexity region	1206	1217	N/A	INTRINSIC
Blast:HisKA	1270	1326	1e-24	BLAST
low complexity region	1327	1348	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169371
AA Change: S508P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: S508P

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.24e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.24e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	972	1113	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
Blast:HisKA	1269	1325	1e-24	BLAST
low complexity region	1326	1347	N/A	INTRINSIC

Meta Mutation Damage Score

0.1493

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.3%
20x: 94.6%

Validation Efficiency

100% (40/40)

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921528I07Rik	T	C	9: 114,301,702		noncoding transcript	Het
Apob	A	G	12: 8,006,017	K1500E	probably benign	Het
Atp8b1	A	T	18: 64,573,262	Y225*	probably null	Het
Cdc25c	A	T	18: 34,748,973		probably benign	Het
Ceacam15	T	C	7: 16,672,075	N184D	probably benign	Het
Dhx34	A	G	7: 16,218,368	S111P	probably damaging	Het
Dst	A	G	1: 34,164,167	E759G	probably damaging	Het
Fis1	G	A	5: 136,965,146	A28T	probably damaging	Het
Fsd1	T	C	17: 55,990,542		probably null	Het
Gm15293	T	A	8: 21,202,433	F90Y	probably benign	Het
Grk6	T	C	13: 55,454,527		probably null	Het
Il23r	A	T	6: 67,473,810	H228Q	probably benign	Het
Kcnh4	C	T	11: 100,752,338	V368I	possibly damaging	Het
Kdr	T	C	5: 75,956,231	E728G	probably damaging	Het
Krt33a	T	A	11: 100,015,937	M71L	probably benign	Het
Lrrc7	T	G	3: 158,161,143	D987A	probably damaging	Het
Naalad2	C	T	9: 18,347,506	R491Q	probably damaging	Het
Nedd4l	A	T	18: 65,167,499		probably benign	Het
Pramel7	A	G	2: 87,491,190	L167S	probably damaging	Het
Prkci	A	G	3: 31,050,192	D568G	probably damaging	Het
Psg18	G	A	7: 18,351,075	T32I	possibly damaging	Het
Ric8b	T	A	10: 84,970,717		probably benign	Het
Rnf213	T	C	11: 119,485,998		probably benign	Het
Rttn	T	C	18: 89,064,249	V1433A	probably damaging	Het
Sbf2	A	T	7: 110,367,172		probably benign	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Sfta2	T	C	17: 35,650,127		probably benign	Het
Slc17a1	T	A	13: 23,878,450		probably benign	Het
Slc6a21	G	A	7: 45,288,202	C314Y	probably benign	Het
Smpd4	T	C	16: 17,623,969	V35A	probably damaging	Het
Sorl1	T	C	9: 42,014,490	D1182G	probably damaging	Het
Syne2	A	G	12: 76,042,035	I5056V	possibly damaging	Het
Tex14	T	C	11: 87,519,745		probably benign	Het
Tex44	A	G	1: 86,427,055	T229A	probably benign	Het
Tfap2b	T	A	1: 19,234,149	C394*	probably null	Het
Ttk	T	A	9: 83,844,149		probably benign	Het
Vmn2r26	G	A	6: 124,053,913	V536I	probably benign	Het
Wac	A	G	18: 7,921,916	T553A	probably damaging	Het
Wdcp	T	A	12: 4,850,685	H180Q	probably damaging	Het
Wdr33	A	G	18: 31,835,461	H235R	probably benign	Het

Other mutations in Cntln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Cntln	APN	4	85006434	missense	probably benign	0.25
IGL00743:Cntln	APN	4	84979415	missense	probably benign	0.06
IGL01014:Cntln	APN	4	85049908	missense	probably benign	0.25
IGL02217:Cntln	APN	4	85100258	missense	probably damaging	1.00
IGL02323:Cntln	APN	4	85049789	missense	probably benign	0.00
IGL02353:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02360:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02616:Cntln	APN	4	85115452	critical splice donor site	probably null
PIT4696001:Cntln	UTSW	4	84974000	missense	probably damaging	0.99
R0110:Cntln	UTSW	4	85096757	missense	probably damaging	1.00
R0324:Cntln	UTSW	4	85092695	missense	probably damaging	0.98
R0349:Cntln	UTSW	4	84996485	missense	probably damaging	1.00
R0519:Cntln	UTSW	4	85005053	splice site	probably benign
R0529:Cntln	UTSW	4	85067825	missense	probably damaging	1.00
R0582:Cntln	UTSW	4	84884741	missense	probably damaging	1.00
R1345:Cntln	UTSW	4	84973991	missense	probably damaging	1.00
R1457:Cntln	UTSW	4	85096839	missense	probably benign	0.33
R1571:Cntln	UTSW	4	84947586	nonsense	probably null
R1622:Cntln	UTSW	4	85063181	missense	probably damaging	1.00
R1681:Cntln	UTSW	4	84947635	missense	probably damaging	1.00
R1777:Cntln	UTSW	4	85130679	missense	probably benign	0.23
R1808:Cntln	UTSW	4	85096763	missense	probably damaging	1.00
R1882:Cntln	UTSW	4	85100835	missense	probably damaging	1.00
R2056:Cntln	UTSW	4	85049674	missense	probably benign
R2965:Cntln	UTSW	4	84974027	critical splice donor site	probably null
R2968:Cntln	UTSW	4	84957267	missense	probably benign	0.27
R3104:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3106:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3121:Cntln	UTSW	4	85005052	splice site	probably benign
R3617:Cntln	UTSW	4	85004977	nonsense	probably null
R4009:Cntln	UTSW	4	85063215	missense	probably benign	0.45
R4036:Cntln	UTSW	4	85006488	missense	probably damaging	1.00
R4548:Cntln	UTSW	4	85096842	missense	probably benign	0.27
R4592:Cntln	UTSW	4	84971182	missense	probably benign	0.00
R4666:Cntln	UTSW	4	84971216	missense	probably benign	0.13
R4826:Cntln	UTSW	4	85005044	missense	probably benign	0.03
R4836:Cntln	UTSW	4	85049720	nonsense	probably null
R4856:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4886:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4995:Cntln	UTSW	4	85049883	missense	probably benign	0.00
R5090:Cntln	UTSW	4	84947593	missense	probably damaging	0.98
R5202:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R5905:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R5953:Cntln	UTSW	4	85049919	missense	possibly damaging	0.92
R6028:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R6298:Cntln	UTSW	4	85096761	missense	probably damaging	1.00
R6351:Cntln	UTSW	4	85115354	missense	probably damaging	0.99
R6371:Cntln	UTSW	4	84884579	missense	probably damaging	0.98
R6481:Cntln	UTSW	4	85067510	missense	probably benign	0.00
R6864:Cntln	UTSW	4	85096792	missense	probably damaging	0.99
R6874:Cntln	UTSW	4	85067759	missense	probably damaging	1.00
R6919:Cntln	UTSW	4	85115368	missense	probably benign	0.04
R7071:Cntln	UTSW	4	85100385	missense	probably damaging	1.00
R7113:Cntln	UTSW	4	85049827	missense	probably damaging	0.98
R7152:Cntln	UTSW	4	84884700	missense	possibly damaging	0.87
R7253:Cntln	UTSW	4	85118473	missense	probably damaging	1.00
R7289:Cntln	UTSW	4	85046303	missense	possibly damaging	0.80
R7440:Cntln	UTSW	4	85063216	missense	possibly damaging	0.95
R7670:Cntln	UTSW	4	84979340	missense	possibly damaging	0.66
R7707:Cntln	UTSW	4	84884616	missense	probably damaging	1.00
R7895:Cntln	UTSW	4	85063324	missense	possibly damaging	0.91
R8176:Cntln	UTSW	4	84888689	missense	probably damaging	0.99
R8247:Cntln	UTSW	4	85100780	missense	probably benign	0.39
R8264:Cntln	UTSW	4	85098411	missense	probably damaging	1.00
R8293:Cntln	UTSW	4	85033838	missense	probably damaging	1.00
R8536:Cntln	UTSW	4	84957049	missense	probably damaging	1.00
R8844:Cntln	UTSW	4	84973997	missense	probably damaging	1.00
R8924:Cntln	UTSW	4	84888699	missense	probably damaging	1.00
R8955:Cntln	UTSW	4	85067873	missense	possibly damaging	0.85
R8960:Cntln	UTSW	4	85100724	missense	possibly damaging	0.59

Predicted Primers

PCR Primer
(F):5'- CTCGGGTATTCCATGCAGGACTTTT -3'
(R):5'- ACAGCATCTCTAAGTGACCTCAGTGAA -3'

Sequencing Primer
(F):5'- TCAGCCAGTTCAACCATGTC -3'
(R):5'- TGATGCTTAACCCAATCTAGTCTG -3'

Posted On

2013-11-18