Incidental Mutation 'R1077:Fis1'
ID85679
Institutional Source Beutler Lab
Gene Symbol Fis1
Ensembl Gene ENSMUSG00000019054
Gene Namefission, mitochondrial 1
SynonymsTtc11
MMRRC Submission 039163-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1077 (G1)
Quality Score221
Status Validated
Chromosome5
Chromosomal Location136953275-136966234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 136965146 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 28 (A28T)
Ref Sequence ENSEMBL: ENSMUSP00000106726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001790] [ENSMUST00000019198] [ENSMUST00000111093] [ENSMUST00000111094] [ENSMUST00000111097]
Predicted Effect probably benign
Transcript: ENSMUST00000001790
SMART Domains Protein: ENSMUSP00000001790
Gene: ENSMUSG00000001739

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 2 179 6.4e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000019198
AA Change: A78T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019198
Gene: ENSMUSG00000019054
AA Change: A78T

DomainStartEndE-ValueType
Pfam:Fis1_TPR_N 33 65 2.3e-18 PFAM
Pfam:Fis1_TPR_C 71 123 2.1e-27 PFAM
low complexity region 124 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111093
SMART Domains Protein: ENSMUSP00000106722
Gene: ENSMUSG00000001739

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 2 179 6.5e-36 PFAM
Pfam:Claudin_2 12 181 2.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111094
AA Change: A71T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106723
Gene: ENSMUSG00000019054
AA Change: A71T

DomainStartEndE-ValueType
Pfam:Fis1_TPR_N 25 59 3.1e-20 PFAM
Pfam:Fis1_TPR_C 64 116 6.1e-28 PFAM
low complexity region 117 140 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111097
AA Change: A28T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106726
Gene: ENSMUSG00000019054
AA Change: A28T

DomainStartEndE-ValueType
Pfam:Fis1_TPR_C 21 73 1.4e-28 PFAM
low complexity region 74 97 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152658
Meta Mutation Damage Score 0.6522 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The balance between fission and fusion regulates the morphology of mitochondria. TTC11 is a component of a mitochondrial complex that promotes mitochondrial fission (James et al., 2003 [PubMed 12783892]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik T C 9: 114,301,702 noncoding transcript Het
Apob A G 12: 8,006,017 K1500E probably benign Het
Atp8b1 A T 18: 64,573,262 Y225* probably null Het
Cdc25c A T 18: 34,748,973 probably benign Het
Ceacam15 T C 7: 16,672,075 N184D probably benign Het
Cntln T C 4: 84,996,479 S508P probably damaging Het
Dhx34 A G 7: 16,218,368 S111P probably damaging Het
Dst A G 1: 34,164,167 E759G probably damaging Het
Fsd1 T C 17: 55,990,542 probably null Het
Gm15293 T A 8: 21,202,433 F90Y probably benign Het
Grk6 T C 13: 55,454,527 probably null Het
Il23r A T 6: 67,473,810 H228Q probably benign Het
Kcnh4 C T 11: 100,752,338 V368I possibly damaging Het
Kdr T C 5: 75,956,231 E728G probably damaging Het
Krt33a T A 11: 100,015,937 M71L probably benign Het
Lrrc7 T G 3: 158,161,143 D987A probably damaging Het
Naalad2 C T 9: 18,347,506 R491Q probably damaging Het
Nedd4l A T 18: 65,167,499 probably benign Het
Pramel7 A G 2: 87,491,190 L167S probably damaging Het
Prkci A G 3: 31,050,192 D568G probably damaging Het
Psg18 G A 7: 18,351,075 T32I possibly damaging Het
Ric8b T A 10: 84,970,717 probably benign Het
Rnf213 T C 11: 119,485,998 probably benign Het
Rttn T C 18: 89,064,249 V1433A probably damaging Het
Sbf2 A T 7: 110,367,172 probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sfta2 T C 17: 35,650,127 probably benign Het
Slc17a1 T A 13: 23,878,450 probably benign Het
Slc6a21 G A 7: 45,288,202 C314Y probably benign Het
Smpd4 T C 16: 17,623,969 V35A probably damaging Het
Sorl1 T C 9: 42,014,490 D1182G probably damaging Het
Syne2 A G 12: 76,042,035 I5056V possibly damaging Het
Tex14 T C 11: 87,519,745 probably benign Het
Tex44 A G 1: 86,427,055 T229A probably benign Het
Tfap2b T A 1: 19,234,149 C394* probably null Het
Ttk T A 9: 83,844,149 probably benign Het
Vmn2r26 G A 6: 124,053,913 V536I probably benign Het
Wac A G 18: 7,921,916 T553A probably damaging Het
Wdcp T A 12: 4,850,685 H180Q probably damaging Het
Wdr33 A G 18: 31,835,461 H235R probably benign Het
Other mutations in Fis1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Fis1 APN 5 136965974 missense probably benign 0.38
R0650:Fis1 UTSW 5 136962194 missense probably damaging 0.98
R1920:Fis1 UTSW 5 136965607 missense probably benign 0.07
R2848:Fis1 UTSW 5 136963117 missense possibly damaging 0.91
R2849:Fis1 UTSW 5 136963117 missense possibly damaging 0.91
R4678:Fis1 UTSW 5 136963097 missense possibly damaging 0.67
R5410:Fis1 UTSW 5 136965566 missense probably damaging 1.00
R6229:Fis1 UTSW 5 136965674 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTGGGAATGCACCCATCCATACAG -3'
(R):5'- TCCTGCAATCAGAGGAAAGGCAC -3'

Sequencing Primer
(F):5'- GCTGTAACTGGGAAGCTGC -3'
(R):5'- CTAGCAGAGATAACAGCTCCAGG -3'
Posted On2013-11-18