Mutagenetix > Incidental Mutations

Incidental Mutation 'R1077:Vmn2r26'

85681

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r26

Ensembl Gene

ENSMUSG00000096630

Gene Name

vomeronasal 2, receptor 26

Synonyms

V2r1b

MMRRC Submission

039163-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.368) question?

Stock #

R1077 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124024758-124062035 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 124053913 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 536 (V536I)

Ref Sequence

ENSEMBL: ENSMUSP00000032238 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032238]

Predicted Effect

probably benign
Transcript: ENSMUST00000032238
AA Change: V536I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: V536I

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	82	471	1.5e-31	PFAM
Pfam:NCD3G	519	572	4.6e-25	PFAM
Pfam:7tm_3	603	840	1.5e-55	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158682

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.3%
20x: 94.6%

Validation Efficiency

100% (40/40)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921528I07Rik	T	C	9: 114,301,702		noncoding transcript	Het
Apob	A	G	12: 8,006,017	K1500E	probably benign	Het
Atp8b1	A	T	18: 64,573,262	Y225*	probably null	Het
Cdc25c	A	T	18: 34,748,973		probably benign	Het
Ceacam15	T	C	7: 16,672,075	N184D	probably benign	Het
Cntln	T	C	4: 84,996,479	S508P	probably damaging	Het
Dhx34	A	G	7: 16,218,368	S111P	probably damaging	Het
Dst	A	G	1: 34,164,167	E759G	probably damaging	Het
Fis1	G	A	5: 136,965,146	A28T	probably damaging	Het
Fsd1	T	C	17: 55,990,542		probably null	Het
Gm15293	T	A	8: 21,202,433	F90Y	probably benign	Het
Grk6	T	C	13: 55,454,527		probably null	Het
Il23r	A	T	6: 67,473,810	H228Q	probably benign	Het
Kcnh4	C	T	11: 100,752,338	V368I	possibly damaging	Het
Kdr	T	C	5: 75,956,231	E728G	probably damaging	Het
Krt33a	T	A	11: 100,015,937	M71L	probably benign	Het
Lrrc7	T	G	3: 158,161,143	D987A	probably damaging	Het
Naalad2	C	T	9: 18,347,506	R491Q	probably damaging	Het
Nedd4l	A	T	18: 65,167,499		probably benign	Het
Pramel7	A	G	2: 87,491,190	L167S	probably damaging	Het
Prkci	A	G	3: 31,050,192	D568G	probably damaging	Het
Psg18	G	A	7: 18,351,075	T32I	possibly damaging	Het
Ric8b	T	A	10: 84,970,717		probably benign	Het
Rnf213	T	C	11: 119,485,998		probably benign	Het
Rttn	T	C	18: 89,064,249	V1433A	probably damaging	Het
Sbf2	A	T	7: 110,367,172		probably benign	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Sfta2	T	C	17: 35,650,127		probably benign	Het
Slc17a1	T	A	13: 23,878,450		probably benign	Het
Slc6a21	G	A	7: 45,288,202	C314Y	probably benign	Het
Smpd4	T	C	16: 17,623,969	V35A	probably damaging	Het
Sorl1	T	C	9: 42,014,490	D1182G	probably damaging	Het
Syne2	A	G	12: 76,042,035	I5056V	possibly damaging	Het
Tex14	T	C	11: 87,519,745		probably benign	Het
Tex44	A	G	1: 86,427,055	T229A	probably benign	Het
Tfap2b	T	A	1: 19,234,149	C394*	probably null	Het
Ttk	T	A	9: 83,844,149		probably benign	Het
Wac	A	G	18: 7,921,916	T553A	probably damaging	Het
Wdcp	T	A	12: 4,850,685	H180Q	probably damaging	Het
Wdr33	A	G	18: 31,835,461	H235R	probably benign	Het

Other mutations in Vmn2r26

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01070:Vmn2r26	APN	6	124061607	missense	probably benign	0.00
IGL01370:Vmn2r26	APN	6	124061756	missense	probably benign	0.08
IGL01603:Vmn2r26	APN	6	124053874	missense	probably damaging	1.00
IGL01651:Vmn2r26	APN	6	124050673	missense	probably benign	0.01
IGL02282:Vmn2r26	APN	6	124061625	missense	probably damaging	1.00
IGL02425:Vmn2r26	APN	6	124061818	missense	probably damaging	1.00
IGL02551:Vmn2r26	APN	6	124026141	missense	probably benign	0.11
IGL02690:Vmn2r26	APN	6	124026132	missense	probably benign	0.14
IGL03002:Vmn2r26	APN	6	124039795	missense	possibly damaging	0.78
IGL03270:Vmn2r26	APN	6	124050819	missense	probably benign	0.16
R0032:Vmn2r26	UTSW	6	124039899	missense	possibly damaging	0.72
R0052:Vmn2r26	UTSW	6	124062033	makesense	probably null
R0083:Vmn2r26	UTSW	6	124053981	splice site	probably null
R0682:Vmn2r26	UTSW	6	124061170	missense	probably damaging	0.97
R1061:Vmn2r26	UTSW	6	124061644	missense	probably benign	0.12
R1263:Vmn2r26	UTSW	6	124050708	missense	probably benign
R1579:Vmn2r26	UTSW	6	124039747	missense	probably benign	0.00
R1741:Vmn2r26	UTSW	6	124061472	missense	probably damaging	1.00
R1834:Vmn2r26	UTSW	6	124061410	missense	possibly damaging	0.54
R1838:Vmn2r26	UTSW	6	124024771	missense	probably benign
R1956:Vmn2r26	UTSW	6	124053887	missense	probably damaging	1.00
R1996:Vmn2r26	UTSW	6	124061185	missense	probably damaging	1.00
R2140:Vmn2r26	UTSW	6	124061237	missense	probably benign	0.01
R2327:Vmn2r26	UTSW	6	124039749	missense	probably benign	0.07
R2417:Vmn2r26	UTSW	6	124061350	missense	probably damaging	1.00
R3930:Vmn2r26	UTSW	6	124025979	missense	probably benign
R4490:Vmn2r26	UTSW	6	124050738	missense	possibly damaging	0.47
R4629:Vmn2r26	UTSW	6	124061191	missense	possibly damaging	0.50
R4655:Vmn2r26	UTSW	6	124061416	missense	probably damaging	1.00
R4709:Vmn2r26	UTSW	6	124053965	missense	probably damaging	1.00
R4992:Vmn2r26	UTSW	6	124026111	missense	probably benign	0.00
R5297:Vmn2r26	UTSW	6	124061873	missense	probably damaging	1.00
R5482:Vmn2r26	UTSW	6	124061326	missense	possibly damaging	0.88
R5517:Vmn2r26	UTSW	6	124050717	missense	probably damaging	1.00
R5737:Vmn2r26	UTSW	6	124039449	missense	probably benign	0.00
R5739:Vmn2r26	UTSW	6	124025966	missense	probably benign	0.00
R5873:Vmn2r26	UTSW	6	124061674	missense	probably benign	0.01
R5907:Vmn2r26	UTSW	6	124039871	missense	probably benign	0.00
R6086:Vmn2r26	UTSW	6	124039560	missense	possibly damaging	0.48
R6134:Vmn2r26	UTSW	6	124061485	missense	probably damaging	0.97
R6391:Vmn2r26	UTSW	6	124061389	missense	probably damaging	1.00
R6428:Vmn2r26	UTSW	6	124026080	missense	probably benign	0.17
R6637:Vmn2r26	UTSW	6	124061691	missense	probably damaging	1.00
R6927:Vmn2r26	UTSW	6	124039098	missense	possibly damaging	0.93
R6953:Vmn2r26	UTSW	6	124039782	missense	probably benign	0.00
R7173:Vmn2r26	UTSW	6	124061296	missense	probably benign	0.16
R7206:Vmn2r26	UTSW	6	124039768	missense	probably benign	0.17
R7208:Vmn2r26	UTSW	6	124061989	missense	probably damaging	1.00
R7283:Vmn2r26	UTSW	6	124025955	missense	probably damaging	0.97
R7506:Vmn2r26	UTSW	6	124039741	missense	probably benign	0.00
R7672:Vmn2r26	UTSW	6	124039647	missense	probably benign	0.25
R7674:Vmn2r26	UTSW	6	124039362	missense	probably benign
R7696:Vmn2r26	UTSW	6	124061535	missense	possibly damaging	0.94
R7716:Vmn2r26	UTSW	6	124061745	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTTAAAGTACACAGATGCTCTGCTGA -3'
(R):5'- GGTGTTGTGTTACTCACCCCTATCCT -3'

Sequencing Primer
(F):5'- CACAGATGCTCTGCTGAAATTTACC -3'
(R):5'- GTGCATCATTTCCACATTCAGAATC -3'

Posted On

2013-11-18