Incidental Mutation 'R1077:Dhx34'
ID 85682
Institutional Source Beutler Lab
Gene Symbol Dhx34
Ensembl Gene ENSMUSG00000006019
Gene Name DEAH (Asp-Glu-Ala-His) box polypeptide 34
Synonyms 1200013B07Rik, Ddx34, 1810012L18Rik
MMRRC Submission 039163-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.369) question?
Stock # R1077 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 16197147-16222037 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 16218368 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 111 (S111P)
Ref Sequence ENSEMBL: ENSMUSP00000126915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094816] [ENSMUST00000118795] [ENSMUST00000119102] [ENSMUST00000121123] [ENSMUST00000163968]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000094816
AA Change: S111P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092410
Gene: ENSMUSG00000006019
AA Change: S111P

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
DEXDc 150 343 7.73e-28 SMART
HELICc 400 498 4.31e-17 SMART
low complexity region 542 553 N/A INTRINSIC
HA2 558 648 3.35e-21 SMART
Pfam:OB_NTP_bind 687 911 2.6e-24 PFAM
low complexity region 953 971 N/A INTRINSIC
ZnF_C2H2 1121 1144 7.89e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118795
AA Change: S111P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112865
Gene: ENSMUSG00000006019
AA Change: S111P

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
DEXDc 150 343 7.73e-28 SMART
HELICc 400 498 4.31e-17 SMART
low complexity region 542 553 N/A INTRINSIC
HA2 558 648 3.35e-21 SMART
Pfam:OB_NTP_bind 687 911 7.5e-17 PFAM
low complexity region 953 971 N/A INTRINSIC
ZnF_C2H2 1121 1144 7.89e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119102
AA Change: S111P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113393
Gene: ENSMUSG00000006019
AA Change: S111P

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
DEXDc 150 343 7.73e-28 SMART
HELICc 400 498 4.31e-17 SMART
low complexity region 542 553 N/A INTRINSIC
HA2 558 648 3.35e-21 SMART
Pfam:OB_NTP_bind 687 911 7.5e-17 PFAM
low complexity region 953 971 N/A INTRINSIC
ZnF_C2H2 1121 1144 7.89e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121123
AA Change: S111P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113673
Gene: ENSMUSG00000006019
AA Change: S111P

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
DEXDc 150 343 7.73e-28 SMART
HELICc 400 498 4.31e-17 SMART
low complexity region 542 553 N/A INTRINSIC
HA2 558 648 3.35e-21 SMART
Pfam:OB_NTP_bind 687 911 7.5e-17 PFAM
low complexity region 953 971 N/A INTRINSIC
ZnF_C2H2 1121 1144 7.89e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163968
AA Change: S111P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126915
Gene: ENSMUSG00000006019
AA Change: S111P

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
DEXDc 150 343 7.73e-28 SMART
HELICc 400 498 4.31e-17 SMART
low complexity region 542 553 N/A INTRINSIC
HA2 558 648 3.35e-21 SMART
Pfam:OB_NTP_bind 687 911 6.4e-18 PFAM
low complexity region 953 971 N/A INTRINSIC
ZnF_C2H2 1121 1144 7.89e0 SMART
Meta Mutation Damage Score 0.2031 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. It is mapped to the glioma 19q tumor suppressor region and is a tumor suppressor candidate gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik T C 9: 114,301,702 noncoding transcript Het
Apob A G 12: 8,006,017 K1500E probably benign Het
Atp8b1 A T 18: 64,573,262 Y225* probably null Het
Cdc25c A T 18: 34,748,973 probably benign Het
Ceacam15 T C 7: 16,672,075 N184D probably benign Het
Cntln T C 4: 84,996,479 S508P probably damaging Het
Dst A G 1: 34,164,167 E759G probably damaging Het
Fis1 G A 5: 136,965,146 A28T probably damaging Het
Fsd1 T C 17: 55,990,542 probably null Het
Gm15293 T A 8: 21,202,433 F90Y probably benign Het
Grk6 T C 13: 55,454,527 probably null Het
Il23r A T 6: 67,473,810 H228Q probably benign Het
Kcnh4 C T 11: 100,752,338 V368I possibly damaging Het
Kdr T C 5: 75,956,231 E728G probably damaging Het
Krt33a T A 11: 100,015,937 M71L probably benign Het
Lrrc7 T G 3: 158,161,143 D987A probably damaging Het
Naalad2 C T 9: 18,347,506 R491Q probably damaging Het
Nedd4l A T 18: 65,167,499 probably benign Het
Pramel7 A G 2: 87,491,190 L167S probably damaging Het
Prkci A G 3: 31,050,192 D568G probably damaging Het
Psg18 G A 7: 18,351,075 T32I possibly damaging Het
Ric8b T A 10: 84,970,717 probably benign Het
Rnf213 T C 11: 119,485,998 probably benign Het
Rttn T C 18: 89,064,249 V1433A probably damaging Het
Sbf2 A T 7: 110,367,172 probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sfta2 T C 17: 35,650,127 probably benign Het
Slc17a1 T A 13: 23,878,450 probably benign Het
Slc6a21 G A 7: 45,288,202 C314Y probably benign Het
Smpd4 T C 16: 17,623,969 V35A probably damaging Het
Sorl1 T C 9: 42,014,490 D1182G probably damaging Het
Syne2 A G 12: 76,042,035 I5056V possibly damaging Het
Tex14 T C 11: 87,519,745 probably benign Het
Tex44 A G 1: 86,427,055 T229A probably benign Het
Tfap2b T A 1: 19,234,149 C394* probably null Het
Ttk T A 9: 83,844,149 probably benign Het
Vmn2r26 G A 6: 124,053,913 V536I probably benign Het
Wac A G 18: 7,921,916 T553A probably damaging Het
Wdcp T A 12: 4,850,685 H180Q probably damaging Het
Wdr33 A G 18: 31,835,461 H235R probably benign Het
Other mutations in Dhx34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Dhx34 APN 7 16199826 missense probably damaging 1.00
IGL01090:Dhx34 APN 7 16216256 missense probably damaging 1.00
IGL01397:Dhx34 APN 7 16210543 missense probably damaging 1.00
IGL01637:Dhx34 APN 7 16205473 missense probably damaging 1.00
IGL01684:Dhx34 APN 7 16203279 missense probably damaging 1.00
IGL02147:Dhx34 APN 7 16204003 missense probably benign 0.01
IGL02223:Dhx34 APN 7 16198659 missense probably benign 0.10
R0255:Dhx34 UTSW 7 16205992 missense probably benign 0.32
R0514:Dhx34 UTSW 7 16210537 missense probably benign 0.02
R0919:Dhx34 UTSW 7 16201958 missense probably damaging 0.99
R1075:Dhx34 UTSW 7 16218349 missense probably benign 0.06
R4197:Dhx34 UTSW 7 16203726 missense probably damaging 1.00
R4721:Dhx34 UTSW 7 16197382 missense possibly damaging 0.83
R4856:Dhx34 UTSW 7 16215442 missense possibly damaging 0.94
R4868:Dhx34 UTSW 7 16199802 missense probably benign 0.10
R5134:Dhx34 UTSW 7 16218250 missense possibly damaging 0.57
R5180:Dhx34 UTSW 7 16205480 nonsense probably null
R5560:Dhx34 UTSW 7 16218541 missense probably benign 0.34
R5588:Dhx34 UTSW 7 16198900 missense probably damaging 0.99
R6981:Dhx34 UTSW 7 16215330 missense possibly damaging 0.87
R6994:Dhx34 UTSW 7 16203874 missense probably benign 0.04
R7226:Dhx34 UTSW 7 16198876 missense probably damaging 1.00
R7262:Dhx34 UTSW 7 16203698 missense probably benign 0.01
R7288:Dhx34 UTSW 7 16215436 missense probably benign 0.08
R7381:Dhx34 UTSW 7 16215448 missense probably benign 0.00
R7469:Dhx34 UTSW 7 16216439 missense probably benign 0.00
R7709:Dhx34 UTSW 7 16212864 missense possibly damaging 0.55
R7862:Dhx34 UTSW 7 16210523 missense probably damaging 0.98
R8495:Dhx34 UTSW 7 16218547 missense probably benign 0.01
R8885:Dhx34 UTSW 7 16216451 missense probably damaging 1.00
R9246:Dhx34 UTSW 7 16203237 missense probably damaging 1.00
X0020:Dhx34 UTSW 7 16205992 missense probably benign 0.32
Z1176:Dhx34 UTSW 7 16218644 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGTACTGGGGCACCTGAGTAGAC -3'
(R):5'- TCGTGGTTCAGAGGAGTGTCAGAAG -3'

Sequencing Primer
(F):5'- TGAGTAGACTTGCCACAGC -3'
(R):5'- AGTGTCAGAAGTTCTGGGC -3'
Posted On 2013-11-18