Incidental Mutation 'R1077:Slc6a21'
ID85685
Institutional Source Beutler Lab
Gene Symbol Slc6a21
Ensembl Gene ENSMUSG00000070568
Gene Namesolute carrier family 6 member 21
Synonyms1700039E15Rik
MMRRC Submission 039163-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R1077 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45277513-45288998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45288202 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 314 (C314Y)
Ref Sequence ENSEMBL: ENSMUSP00000082476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085364] [ENSMUST00000210861]
Predicted Effect probably benign
Transcript: ENSMUST00000085364
AA Change: C314Y

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000082476
Gene: ENSMUSG00000070568
AA Change: C314Y

DomainStartEndE-ValueType
Pfam:SNF 1 306 8.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176276
AA Change: C639Y

PolyPhen 2 Score 0.219 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135707
Gene: ENSMUSG00000070568
AA Change: C639Y

DomainStartEndE-ValueType
Pfam:SNF 48 631 2e-103 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209886
Predicted Effect probably benign
Transcript: ENSMUST00000210207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210733
Predicted Effect probably benign
Transcript: ENSMUST00000210861
AA Change: C639Y

PolyPhen 2 Score 0.219 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.6%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik T C 9: 114,301,702 noncoding transcript Het
Apob A G 12: 8,006,017 K1500E probably benign Het
Atp8b1 A T 18: 64,573,262 Y225* probably null Het
Cdc25c A T 18: 34,748,973 probably benign Het
Ceacam15 T C 7: 16,672,075 N184D probably benign Het
Cntln T C 4: 84,996,479 S508P probably damaging Het
Dhx34 A G 7: 16,218,368 S111P probably damaging Het
Dst A G 1: 34,164,167 E759G probably damaging Het
Fis1 G A 5: 136,965,146 A28T probably damaging Het
Fsd1 T C 17: 55,990,542 probably null Het
Gm15293 T A 8: 21,202,433 F90Y probably benign Het
Grk6 T C 13: 55,454,527 probably null Het
Il23r A T 6: 67,473,810 H228Q probably benign Het
Kcnh4 C T 11: 100,752,338 V368I possibly damaging Het
Kdr T C 5: 75,956,231 E728G probably damaging Het
Krt33a T A 11: 100,015,937 M71L probably benign Het
Lrrc7 T G 3: 158,161,143 D987A probably damaging Het
Naalad2 C T 9: 18,347,506 R491Q probably damaging Het
Nedd4l A T 18: 65,167,499 probably benign Het
Pramel7 A G 2: 87,491,190 L167S probably damaging Het
Prkci A G 3: 31,050,192 D568G probably damaging Het
Psg18 G A 7: 18,351,075 T32I possibly damaging Het
Ric8b T A 10: 84,970,717 probably benign Het
Rnf213 T C 11: 119,485,998 probably benign Het
Rttn T C 18: 89,064,249 V1433A probably damaging Het
Sbf2 A T 7: 110,367,172 probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sfta2 T C 17: 35,650,127 probably benign Het
Slc17a1 T A 13: 23,878,450 probably benign Het
Smpd4 T C 16: 17,623,969 V35A probably damaging Het
Sorl1 T C 9: 42,014,490 D1182G probably damaging Het
Syne2 A G 12: 76,042,035 I5056V possibly damaging Het
Tex14 T C 11: 87,519,745 probably benign Het
Tex44 A G 1: 86,427,055 T229A probably benign Het
Tfap2b T A 1: 19,234,149 C394* probably null Het
Ttk T A 9: 83,844,149 probably benign Het
Vmn2r26 G A 6: 124,053,913 V536I probably benign Het
Wac A G 18: 7,921,916 T553A probably damaging Het
Wdcp T A 12: 4,850,685 H180Q probably damaging Het
Wdr33 A G 18: 31,835,461 H235R probably benign Het
Other mutations in Slc6a21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Slc6a21 APN 7 45288244 missense probably benign 0.31
IGL01526:Slc6a21 APN 7 45287796 missense probably damaging 1.00
IGL01670:Slc6a21 APN 7 45288133 missense possibly damaging 0.91
IGL01975:Slc6a21 APN 7 45287851 missense probably benign 0.28
IGL02064:Slc6a21 APN 7 45286459 missense possibly damaging 0.71
IGL02441:Slc6a21 APN 7 45288081 missense probably damaging 1.00
IGL02735:Slc6a21 APN 7 45286637 splice site probably benign
IGL03097:Slc6a21 UTSW 7 45288168 nonsense probably null
R0211:Slc6a21 UTSW 7 45288243 missense possibly damaging 0.90
R0211:Slc6a21 UTSW 7 45288243 missense possibly damaging 0.90
R0269:Slc6a21 UTSW 7 45286908 nonsense probably null
R0336:Slc6a21 UTSW 7 45286468 missense probably damaging 1.00
R1476:Slc6a21 UTSW 7 45272628 missense probably benign 0.09
R1763:Slc6a21 UTSW 7 45287734 nonsense probably null
R1792:Slc6a21 UTSW 7 45280731 missense probably benign 0.04
R1796:Slc6a21 UTSW 7 45280755 missense probably damaging 1.00
R1812:Slc6a21 UTSW 7 45282947 missense probably damaging 1.00
R1868:Slc6a21 UTSW 7 45287828 missense probably benign 0.13
R2121:Slc6a21 UTSW 7 45288462 missense probably benign 0.04
R2129:Slc6a21 UTSW 7 45282773 unclassified probably null
R2294:Slc6a21 UTSW 7 45280528 missense possibly damaging 0.83
R2295:Slc6a21 UTSW 7 45280528 missense possibly damaging 0.83
R2409:Slc6a21 UTSW 7 45280326 missense probably benign 0.15
R2858:Slc6a21 UTSW 7 45280528 missense possibly damaging 0.83
R3498:Slc6a21 UTSW 7 45280842 missense probably damaging 1.00
R3751:Slc6a21 UTSW 7 45280504 missense probably benign
R4297:Slc6a21 UTSW 7 45287762 missense possibly damaging 0.95
R4510:Slc6a21 UTSW 7 45287289 missense probably damaging 1.00
R4511:Slc6a21 UTSW 7 45287289 missense probably damaging 1.00
R4876:Slc6a21 UTSW 7 45280111 nonsense probably null
R4921:Slc6a21 UTSW 7 45288310 missense possibly damaging 0.53
R5485:Slc6a21 UTSW 7 45282542 critical splice donor site probably null
R5559:Slc6a21 UTSW 7 45288429 missense possibly damaging 0.61
R6305:Slc6a21 UTSW 7 45280604 missense possibly damaging 0.88
R6390:Slc6a21 UTSW 7 45287002 missense probably benign 0.02
R6571:Slc6a21 UTSW 7 45280879 missense probably damaging 0.99
R6792:Slc6a21 UTSW 7 45279885 start codon destroyed probably null 0.02
R7235:Slc6a21 UTSW 7 45280758 missense probably damaging 0.99
R7278:Slc6a21 UTSW 7 45282480 missense possibly damaging 0.84
R7808:Slc6a21 UTSW 7 45282936 missense
Predicted Primers PCR Primer
(F):5'- TGGAATGATAGCATGGTGCGGC -3'
(R):5'- TGTACTTTGACACCTCATGGATGGC -3'

Sequencing Primer
(F):5'- CTACCCTCAGAGACCTGGAG -3'
(R):5'- AAGGTGGAATAGTTCTCACTGTCC -3'
Posted On2013-11-18