Incidental Mutation 'R1077:Ric8b'
ID85692
Institutional Source Beutler Lab
Gene Symbol Ric8b
Ensembl Gene ENSMUSG00000035620
Gene NameRIC8 guanine nucleotide exchange factor B
SynonymsRic-8b, Ric-8
MMRRC Submission 039163-MU
Accession Numbers

Genbank: NM_001013441, NM_183172; MGI: 2682307

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1077 (G1)
Quality Score195
Status Validated
Chromosome10
Chromosomal Location84917616-85018337 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 84970717 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038523] [ENSMUST00000095385] [ENSMUST00000214693]
Predicted Effect probably benign
Transcript: ENSMUST00000038523
SMART Domains Protein: ENSMUSP00000046981
Gene: ENSMUSG00000035620

DomainStartEndE-ValueType
Pfam:Ric8 66 538 8.1e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095385
SMART Domains Protein: ENSMUSP00000093032
Gene: ENSMUSG00000035620

DomainStartEndE-ValueType
Pfam:Ric8 66 486 1.2e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217175
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.6%
Validation Efficiency 100% (40/40)
Allele List at MGI

All alleles(24) : Targeted, other(4) Gene trapped(20)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik T C 9: 114,301,702 noncoding transcript Het
Apob A G 12: 8,006,017 K1500E probably benign Het
Atp8b1 A T 18: 64,573,262 Y225* probably null Het
Cdc25c A T 18: 34,748,973 probably benign Het
Ceacam15 T C 7: 16,672,075 N184D probably benign Het
Cntln T C 4: 84,996,479 S508P probably damaging Het
Dhx34 A G 7: 16,218,368 S111P probably damaging Het
Dst A G 1: 34,164,167 E759G probably damaging Het
Fis1 G A 5: 136,965,146 A28T probably damaging Het
Fsd1 T C 17: 55,990,542 probably null Het
Gm15293 T A 8: 21,202,433 F90Y probably benign Het
Grk6 T C 13: 55,454,527 probably null Het
Il23r A T 6: 67,473,810 H228Q probably benign Het
Kcnh4 C T 11: 100,752,338 V368I possibly damaging Het
Kdr T C 5: 75,956,231 E728G probably damaging Het
Krt33a T A 11: 100,015,937 M71L probably benign Het
Lrrc7 T G 3: 158,161,143 D987A probably damaging Het
Naalad2 C T 9: 18,347,506 R491Q probably damaging Het
Nedd4l A T 18: 65,167,499 probably benign Het
Pramel7 A G 2: 87,491,190 L167S probably damaging Het
Prkci A G 3: 31,050,192 D568G probably damaging Het
Psg18 G A 7: 18,351,075 T32I possibly damaging Het
Rnf213 T C 11: 119,485,998 probably benign Het
Rttn T C 18: 89,064,249 V1433A probably damaging Het
Sbf2 A T 7: 110,367,172 probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sfta2 T C 17: 35,650,127 probably benign Het
Slc17a1 T A 13: 23,878,450 probably benign Het
Slc6a21 G A 7: 45,288,202 C314Y probably benign Het
Smpd4 T C 16: 17,623,969 V35A probably damaging Het
Sorl1 T C 9: 42,014,490 D1182G probably damaging Het
Syne2 A G 12: 76,042,035 I5056V possibly damaging Het
Tex14 T C 11: 87,519,745 probably benign Het
Tex44 A G 1: 86,427,055 T229A probably benign Het
Tfap2b T A 1: 19,234,149 C394* probably null Het
Ttk T A 9: 83,844,149 probably benign Het
Vmn2r26 G A 6: 124,053,913 V536I probably benign Het
Wac A G 18: 7,921,916 T553A probably damaging Het
Wdcp T A 12: 4,850,685 H180Q probably damaging Het
Wdr33 A G 18: 31,835,461 H235R probably benign Het
Other mutations in Ric8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02254:Ric8b APN 10 84980136 missense probably damaging 1.00
IGL02388:Ric8b APN 10 84992271 unclassified probably benign
IGL02435:Ric8b APN 10 84980076 missense probably benign 0.06
IGL02890:Ric8b APN 10 85001867 missense possibly damaging 0.80
IGL03163:Ric8b APN 10 85001822 missense probably damaging 1.00
IGL03211:Ric8b APN 10 85001793 missense probably damaging 1.00
D4216:Ric8b UTSW 10 85015141 missense probably damaging 0.99
R0491:Ric8b UTSW 10 84992222 missense probably damaging 1.00
R0612:Ric8b UTSW 10 85001881 missense probably damaging 1.00
R1448:Ric8b UTSW 10 84947671 missense possibly damaging 0.93
R1565:Ric8b UTSW 10 84980099 missense probably benign 0.01
R1617:Ric8b UTSW 10 84947611 missense probably damaging 0.98
R1634:Ric8b UTSW 10 84970748 missense probably damaging 1.00
R1983:Ric8b UTSW 10 85001838 missense probably damaging 0.99
R2339:Ric8b UTSW 10 84970024 missense probably benign 0.00
R2897:Ric8b UTSW 10 84947897 missense probably benign 0.01
R2898:Ric8b UTSW 10 84947897 missense probably benign 0.01
R4657:Ric8b UTSW 10 84992137 missense probably damaging 1.00
R4747:Ric8b UTSW 10 84917764 missense probably benign 0.36
R4953:Ric8b UTSW 10 84958082 missense possibly damaging 0.92
R5277:Ric8b UTSW 10 84947652 missense probably damaging 0.99
R5308:Ric8b UTSW 10 84947747 missense probably benign
R5326:Ric8b UTSW 10 84992212 missense probably damaging 1.00
R6248:Ric8b UTSW 10 84947845 missense probably damaging 1.00
R6782:Ric8b UTSW 10 84947527 missense probably damaging 1.00
R7548:Ric8b UTSW 10 84947872 missense probably damaging 1.00
R8123:Ric8b UTSW 10 84969873 missense probably damaging 1.00
Z1176:Ric8b UTSW 10 84947544 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGTTTCTCCTGAAAGGCAGCAGTG -3'
(R):5'- GCCCATGAGAGTAACAAGCTCAGTG -3'

Sequencing Primer
(F):5'- GATGGGTCTCAAAATCCTTTGC -3'
(R):5'- GCACAAGATCATTTACTTCTGGC -3'
Posted On2013-11-18