Incidental Mutation 'R1077:Krt33a'
ID85694
Institutional Source Beutler Lab
Gene Symbol Krt33a
Ensembl Gene ENSMUSG00000035592
Gene Namekeratin 33A
Synonyms2310015J09Rik
MMRRC Submission 039163-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1077 (G1)
Quality Score179
Status Validated
Chromosome11
Chromosomal Location100011195-100016212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100015937 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 71 (M71L)
Ref Sequence ENSEMBL: ENSMUSP00000018399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018399]
Predicted Effect probably benign
Transcript: ENSMUST00000018399
AA Change: M71L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018399
Gene: ENSMUSG00000035592
AA Change: M71L

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Filament 55 366 1.99e-148 SMART
internal_repeat_1 368 385 6.11e-5 PROSPERO
internal_repeat_1 384 399 6.11e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138756
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.6%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Mutations of this gene cause the hair coat to appear either shiny, reflective and "polished" or greasy looking, disheveled and "spikey." [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik T C 9: 114,301,702 noncoding transcript Het
Apob A G 12: 8,006,017 K1500E probably benign Het
Atp8b1 A T 18: 64,573,262 Y225* probably null Het
Cdc25c A T 18: 34,748,973 probably benign Het
Ceacam15 T C 7: 16,672,075 N184D probably benign Het
Cntln T C 4: 84,996,479 S508P probably damaging Het
Dhx34 A G 7: 16,218,368 S111P probably damaging Het
Dst A G 1: 34,164,167 E759G probably damaging Het
Fis1 G A 5: 136,965,146 A28T probably damaging Het
Fsd1 T C 17: 55,990,542 probably null Het
Gm15293 T A 8: 21,202,433 F90Y probably benign Het
Grk6 T C 13: 55,454,527 probably null Het
Il23r A T 6: 67,473,810 H228Q probably benign Het
Kcnh4 C T 11: 100,752,338 V368I possibly damaging Het
Kdr T C 5: 75,956,231 E728G probably damaging Het
Lrrc7 T G 3: 158,161,143 D987A probably damaging Het
Naalad2 C T 9: 18,347,506 R491Q probably damaging Het
Nedd4l A T 18: 65,167,499 probably benign Het
Pramel7 A G 2: 87,491,190 L167S probably damaging Het
Prkci A G 3: 31,050,192 D568G probably damaging Het
Psg18 G A 7: 18,351,075 T32I possibly damaging Het
Ric8b T A 10: 84,970,717 probably benign Het
Rnf213 T C 11: 119,485,998 probably benign Het
Rttn T C 18: 89,064,249 V1433A probably damaging Het
Sbf2 A T 7: 110,367,172 probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sfta2 T C 17: 35,650,127 probably benign Het
Slc17a1 T A 13: 23,878,450 probably benign Het
Slc6a21 G A 7: 45,288,202 C314Y probably benign Het
Smpd4 T C 16: 17,623,969 V35A probably damaging Het
Sorl1 T C 9: 42,014,490 D1182G probably damaging Het
Syne2 A G 12: 76,042,035 I5056V possibly damaging Het
Tex14 T C 11: 87,519,745 probably benign Het
Tex44 A G 1: 86,427,055 T229A probably benign Het
Tfap2b T A 1: 19,234,149 C394* probably null Het
Ttk T A 9: 83,844,149 probably benign Het
Vmn2r26 G A 6: 124,053,913 V536I probably benign Het
Wac A G 18: 7,921,916 T553A probably damaging Het
Wdcp T A 12: 4,850,685 H180Q probably damaging Het
Wdr33 A G 18: 31,835,461 H235R probably benign Het
Other mutations in Krt33a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01803:Krt33a APN 11 100012017 missense probably benign 0.35
IGL02412:Krt33a APN 11 100011979 missense probably benign 0.01
IGL02523:Krt33a APN 11 100011692 missense probably benign 0.02
Polished UTSW 11 100012611 missense probably damaging 1.00
Polished2 UTSW 11 100015850 missense probably benign 0.10
Spikey UTSW 11 100011939 missense probably damaging 1.00
R0492:Krt33a UTSW 11 100016083 missense probably benign 0.02
R0496:Krt33a UTSW 11 100012329 splice site probably benign
R0691:Krt33a UTSW 11 100012715 missense probably damaging 1.00
R1624:Krt33a UTSW 11 100014246 missense probably damaging 1.00
R1911:Krt33a UTSW 11 100012349 missense probably benign 0.35
R1944:Krt33a UTSW 11 100012709 missense probably benign 0.10
R1945:Krt33a UTSW 11 100012709 missense probably benign 0.10
R2254:Krt33a UTSW 11 100014178 missense possibly damaging 0.95
R2255:Krt33a UTSW 11 100014178 missense possibly damaging 0.95
R3716:Krt33a UTSW 11 100014165 missense probably benign 0.01
R4377:Krt33a UTSW 11 100012427 missense possibly damaging 0.46
R5233:Krt33a UTSW 11 100014135 missense probably damaging 1.00
R6029:Krt33a UTSW 11 100012463 missense probably benign 0.01
R6316:Krt33a UTSW 11 100014201 missense probably damaging 0.98
R6807:Krt33a UTSW 11 100012383 missense possibly damaging 0.61
R7272:Krt33a UTSW 11 100012011 missense probably damaging 1.00
R7323:Krt33a UTSW 11 100011975 missense probably benign 0.08
R7461:Krt33a UTSW 11 100011939 missense probably damaging 1.00
R7613:Krt33a UTSW 11 100011939 missense probably damaging 1.00
R7657:Krt33a UTSW 11 100015867 missense probably benign
R7748:Krt33a UTSW 11 100011602 missense probably benign
R8183:Krt33a UTSW 11 100014749 critical splice donor site probably null
R8554:Krt33a UTSW 11 100012383 missense possibly damaging 0.61
R8841:Krt33a UTSW 11 100014135 missense probably damaging 1.00
Z1176:Krt33a UTSW 11 100011914 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCCACCACGCCAAGAGTTCATGTC -3'
(R):5'- ACCATGCCATACAACTGCTGCCTG -3'

Sequencing Primer
(F):5'- CCTGAGAACTTCCTGCTAGGAATG -3'
(R):5'- ATGAGCTGCCGCACCAG -3'
Posted On2013-11-18