Incidental Mutation 'R1077:Syne2'
ID 85700
Institutional Source Beutler Lab
Gene Symbol Syne2
Ensembl Gene ENSMUSG00000063450
Gene Name spectrin repeat containing, nuclear envelope 2
Synonyms syne-2, D12Ertd777e, nesprin-2, 6820443O06Rik, Nesp2g
MMRRC Submission 039163-MU
Accession Numbers

Genbank: NM_001005510

Essential gene? Possibly non essential (E-score: 0.412) question?
Stock # R1077 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 75818134-76110926 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 76042035 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 5056 (I5056V)
Ref Sequence ENSEMBL: ENSMUSP00000119120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044217] [ENSMUST00000085280] [ENSMUST00000143031]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000044217
AA Change: I5055V

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047697
Gene: ENSMUSG00000063450
AA Change: I5055V

DomainStartEndE-ValueType
CH 33 134 7.97e-19 SMART
low complexity region 151 175 N/A INTRINSIC
CH 185 283 1.34e-20 SMART
low complexity region 494 505 N/A INTRINSIC
coiled coil region 541 572 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
coiled coil region 844 869 N/A INTRINSIC
coiled coil region 936 969 N/A INTRINSIC
coiled coil region 1006 1032 N/A INTRINSIC
SPEC 1427 1525 4.96e0 SMART
SPEC 1528 1632 2.48e-1 SMART
coiled coil region 1660 1699 N/A INTRINSIC
SPEC 2034 2131 1.83e0 SMART
coiled coil region 2173 2194 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
coiled coil region 2316 2348 N/A INTRINSIC
SPEC 2720 2820 1.44e-5 SMART
coiled coil region 2905 2934 N/A INTRINSIC
coiled coil region 2962 2989 N/A INTRINSIC
coiled coil region 3108 3136 N/A INTRINSIC
low complexity region 3333 3350 N/A INTRINSIC
low complexity region 3514 3523 N/A INTRINSIC
low complexity region 3666 3676 N/A INTRINSIC
coiled coil region 3678 3708 N/A INTRINSIC
coiled coil region 3761 3788 N/A INTRINSIC
coiled coil region 3846 3903 N/A INTRINSIC
coiled coil region 4015 4067 N/A INTRINSIC
low complexity region 4102 4115 N/A INTRINSIC
coiled coil region 4483 4511 N/A INTRINSIC
low complexity region 4557 4569 N/A INTRINSIC
coiled coil region 4655 4688 N/A INTRINSIC
low complexity region 4749 4763 N/A INTRINSIC
SPEC 4827 4926 5.25e-1 SMART
SPEC 4933 5038 2.64e-4 SMART
SPEC 5048 5152 1.47e-2 SMART
SPEC 5159 5259 4.29e0 SMART
SPEC 5263 5371 4.47e0 SMART
low complexity region 5373 5393 N/A INTRINSIC
SPEC 5583 5681 5.7e-1 SMART
Blast:SPEC 5690 5793 2e-53 BLAST
SPEC 5800 5900 2.11e0 SMART
SPEC 5907 6005 6.91e-8 SMART
SPEC 6012 6119 4.45e-11 SMART
SPEC 6126 6228 6.39e-12 SMART
SPEC 6235 6335 7.75e-11 SMART
SPEC 6539 6642 5.53e-7 SMART
SPEC 6649 6753 5.12e-2 SMART
KASH 6817 6874 8.17e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000085280
AA Change: I316V

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000082383
Gene: ENSMUSG00000063450
AA Change: I316V

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
SPEC 88 187 5.25e-1 SMART
SPEC 194 299 2.64e-4 SMART
SPEC 309 413 1.47e-2 SMART
SPEC 420 520 4.29e0 SMART
SPEC 524 632 4.47e0 SMART
low complexity region 634 654 N/A INTRINSIC
SPEC 844 942 5.7e-1 SMART
Blast:SPEC 951 1054 2e-53 BLAST
SPEC 1061 1161 2.11e0 SMART
SPEC 1168 1266 6.91e-8 SMART
SPEC 1273 1380 4.45e-11 SMART
SPEC 1387 1489 6.39e-12 SMART
SPEC 1496 1596 7.75e-11 SMART
SPEC 1823 1926 5.53e-7 SMART
SPEC 1933 2037 5.12e-2 SMART
KASH 2095 2152 8.17e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000143031
AA Change: I5056V

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119120
Gene: ENSMUSG00000063450
AA Change: I5056V

DomainStartEndE-ValueType
CH 33 134 7.97e-19 SMART
low complexity region 151 175 N/A INTRINSIC
CH 185 283 1.34e-20 SMART
low complexity region 494 505 N/A INTRINSIC
coiled coil region 541 572 N/A INTRINSIC
coiled coil region 845 870 N/A INTRINSIC
coiled coil region 937 970 N/A INTRINSIC
coiled coil region 1007 1033 N/A INTRINSIC
SPEC 1428 1526 4.96e0 SMART
SPEC 1529 1633 2.48e-1 SMART
coiled coil region 1661 1700 N/A INTRINSIC
SPEC 2035 2132 1.83e0 SMART
coiled coil region 2174 2195 N/A INTRINSIC
low complexity region 2296 2308 N/A INTRINSIC
coiled coil region 2317 2349 N/A INTRINSIC
SPEC 2721 2821 1.44e-5 SMART
coiled coil region 2906 2935 N/A INTRINSIC
coiled coil region 2963 2990 N/A INTRINSIC
coiled coil region 3109 3137 N/A INTRINSIC
low complexity region 3334 3351 N/A INTRINSIC
low complexity region 3515 3524 N/A INTRINSIC
low complexity region 3667 3677 N/A INTRINSIC
coiled coil region 3679 3709 N/A INTRINSIC
coiled coil region 3762 3789 N/A INTRINSIC
coiled coil region 3847 3904 N/A INTRINSIC
coiled coil region 4016 4068 N/A INTRINSIC
low complexity region 4103 4116 N/A INTRINSIC
coiled coil region 4484 4512 N/A INTRINSIC
low complexity region 4558 4570 N/A INTRINSIC
coiled coil region 4656 4689 N/A INTRINSIC
low complexity region 4750 4764 N/A INTRINSIC
SPEC 4828 4927 5.25e-1 SMART
SPEC 4934 5039 2.64e-4 SMART
SPEC 5049 5153 1.47e-2 SMART
SPEC 5160 5260 4.29e0 SMART
SPEC 5264 5372 4.47e0 SMART
low complexity region 5374 5394 N/A INTRINSIC
SPEC 5584 5682 5.7e-1 SMART
Blast:SPEC 5691 5794 2e-53 BLAST
SPEC 5801 5901 2.11e0 SMART
SPEC 5908 6006 6.91e-8 SMART
SPEC 6013 6120 4.45e-11 SMART
SPEC 6127 6229 6.39e-12 SMART
SPEC 6236 6336 7.75e-11 SMART
SPEC 6540 6643 5.53e-7 SMART
SPEC 6650 6754 5.12e-2 SMART
KASH 6813 6870 8.17e-34 SMART
Meta Mutation Damage Score 0.0801 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear outer membrane protein that binds cytoplasmic F-actin. This binding tethers the nucleus to the cytoskeleton and aids in the maintenance of the structural integrity of the nucleus. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for one knock-out allele show normal myonuclear positioning of both synaptic and non-synaptic nuclei in skeletal muscle cells. Homozygotes for another knock-out allele exhibit a thickened epidermis and altered nuclear envelope architecture inprimary dermal fibroblasts and keratinocytes. Mice homozygous for a spontaneous mutation exhibit early retinal defects in photoreceptors, secondary Neurons, and muller glia. [provided by MGI curators]
Allele List at MGI

 All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik T C 9: 114,301,702 noncoding transcript Het
Apob A G 12: 8,006,017 K1500E probably benign Het
Atp8b1 A T 18: 64,573,262 Y225* probably null Het
Cdc25c A T 18: 34,748,973 probably benign Het
Ceacam15 T C 7: 16,672,075 N184D probably benign Het
Cntln T C 4: 84,996,479 S508P probably damaging Het
Dhx34 A G 7: 16,218,368 S111P probably damaging Het
Dst A G 1: 34,164,167 E759G probably damaging Het
Fis1 G A 5: 136,965,146 A28T probably damaging Het
Fsd1 T C 17: 55,990,542 probably null Het
Gm15293 T A 8: 21,202,433 F90Y probably benign Het
Grk6 T C 13: 55,454,527 probably null Het
Il23r A T 6: 67,473,810 H228Q probably benign Het
Kcnh4 C T 11: 100,752,338 V368I possibly damaging Het
Kdr T C 5: 75,956,231 E728G probably damaging Het
Krt33a T A 11: 100,015,937 M71L probably benign Het
Lrrc7 T G 3: 158,161,143 D987A probably damaging Het
Naalad2 C T 9: 18,347,506 R491Q probably damaging Het
Nedd4l A T 18: 65,167,499 probably benign Het
Pramel7 A G 2: 87,491,190 L167S probably damaging Het
Prkci A G 3: 31,050,192 D568G probably damaging Het
Psg18 G A 7: 18,351,075 T32I possibly damaging Het
Ric8b T A 10: 84,970,717 probably benign Het
Rnf213 T C 11: 119,485,998 probably benign Het
Rttn T C 18: 89,064,249 V1433A probably damaging Het
Sbf2 A T 7: 110,367,172 probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sfta2 T C 17: 35,650,127 probably benign Het
Slc17a1 T A 13: 23,878,450 probably benign Het
Slc6a21 G A 7: 45,288,202 C314Y probably benign Het
Smpd4 T C 16: 17,623,969 V35A probably damaging Het
Sorl1 T C 9: 42,014,490 D1182G probably damaging Het
Tex14 T C 11: 87,519,745 probably benign Het
Tex44 A G 1: 86,427,055 T229A probably benign Het
Tfap2b T A 1: 19,234,149 C394* probably null Het
Ttk T A 9: 83,844,149 probably benign Het
Vmn2r26 G A 6: 124,053,913 V536I probably benign Het
Wac A G 18: 7,921,916 T553A probably damaging Het
Wdcp T A 12: 4,850,685 H180Q probably damaging Het
Wdr33 A G 18: 31,835,461 H235R probably benign Het
Other mutations in Syne2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Syne2 APN 12 76031700 unclassified probably benign
IGL00595:Syne2 APN 12 75925646 missense possibly damaging 0.76
IGL00672:Syne2 APN 12 76064184 missense probably damaging 1.00
IGL00781:Syne2 APN 12 76024062 missense probably benign 0.00
IGL00823:Syne2 APN 12 75989242 missense probably damaging 0.98
IGL01014:Syne2 APN 12 75905277 missense probably damaging 0.99
IGL01074:Syne2 APN 12 76031587 nonsense probably null
IGL01074:Syne2 APN 12 75987011 missense probably benign 0.00
IGL01324:Syne2 APN 12 76043752 missense probably damaging 1.00
IGL01325:Syne2 APN 12 75926514 missense probably benign 0.01
IGL01331:Syne2 APN 12 75929253 splice site probably benign
IGL01338:Syne2 APN 12 76060226 missense possibly damaging 0.55
IGL01373:Syne2 APN 12 75987107 missense probably damaging 1.00
IGL01446:Syne2 APN 12 76041375 missense probably damaging 1.00
IGL01556:Syne2 APN 12 76087815 missense probably damaging 1.00
IGL01585:Syne2 APN 12 75949060 critical splice acceptor site probably null
IGL01629:Syne2 APN 12 76004603 missense possibly damaging 0.49
IGL01686:Syne2 APN 12 75909336 missense probably benign
IGL01935:Syne2 APN 12 75925313 missense probably damaging 1.00
IGL01941:Syne2 APN 12 75967220 missense probably benign 0.01
IGL01956:Syne2 APN 12 76097974 missense probably damaging 1.00
IGL01967:Syne2 APN 12 75941303 missense probably damaging 1.00
IGL01990:Syne2 APN 12 76054933 missense probably damaging 1.00
IGL02000:Syne2 APN 12 76015645 missense probably damaging 0.99
IGL02063:Syne2 APN 12 76052100 missense probably damaging 0.96
IGL02069:Syne2 APN 12 75927412 missense probably benign 0.13
IGL02120:Syne2 APN 12 75946706 missense probably damaging 1.00
IGL02222:Syne2 APN 12 75952843 missense probably damaging 0.96
IGL02223:Syne2 APN 12 76108305 missense probably benign 0.00
IGL02321:Syne2 APN 12 75918999 missense possibly damaging 0.58
IGL02488:Syne2 APN 12 75965738 missense probably benign 0.24
IGL02491:Syne2 APN 12 76072179 missense probably benign 0.10
IGL02525:Syne2 APN 12 76101003 missense probably damaging 0.99
IGL02578:Syne2 APN 12 76022279 missense possibly damaging 0.76
IGL02615:Syne2 APN 12 76096994 missense probably damaging 1.00
IGL02702:Syne2 APN 12 76097924 missense probably damaging 1.00
IGL02726:Syne2 APN 12 76015582 missense probably damaging 0.99
IGL02795:Syne2 APN 12 75966549 missense probably damaging 0.99
IGL02803:Syne2 APN 12 76031546 missense probably damaging 1.00
IGL02814:Syne2 APN 12 75945376 missense possibly damaging 0.64
IGL03013:Syne2 APN 12 75929337 missense probably benign 0.00
IGL03131:Syne2 APN 12 76057490 missense probably damaging 1.00
IGL03152:Syne2 APN 12 75965712 missense probably benign 0.12
IGL03216:Syne2 APN 12 75942961 splice site probably benign
IGL03228:Syne2 APN 12 75979912 missense probably benign 0.01
IGL03259:Syne2 APN 12 75989079 missense probably benign 0.05
IGL03374:Syne2 APN 12 76074586 missense possibly damaging 0.66
IGL03375:Syne2 APN 12 75925435 missense possibly damaging 0.57
3-1:Syne2 UTSW 12 75930632 missense probably benign 0.02
B5639:Syne2 UTSW 12 75929790 missense probably benign
K3955:Syne2 UTSW 12 75930665 missense probably damaging 1.00
P0026:Syne2 UTSW 12 75880220 splice site probably benign
PIT4514001:Syne2 UTSW 12 76105015 missense probably damaging 0.99
R0089:Syne2 UTSW 12 75963876 missense probably damaging 1.00
R0110:Syne2 UTSW 12 76097960 nonsense probably null
R0113:Syne2 UTSW 12 75930578 missense probably damaging 1.00
R0113:Syne2 UTSW 12 76033722 missense probably damaging 1.00
R0141:Syne2 UTSW 12 75941298 missense probably damaging 1.00
R0211:Syne2 UTSW 12 76097957 missense probably damaging 1.00
R0219:Syne2 UTSW 12 76042004 missense probably damaging 1.00
R0242:Syne2 UTSW 12 76098034 missense probably damaging 1.00
R0242:Syne2 UTSW 12 76098034 missense probably damaging 1.00
R0279:Syne2 UTSW 12 76095613 missense probably damaging 1.00
R0319:Syne2 UTSW 12 76064162 missense probably damaging 0.99
R0325:Syne2 UTSW 12 75962641 missense probably benign 0.00
R0329:Syne2 UTSW 12 75966953 missense probably benign
R0330:Syne2 UTSW 12 75966953 missense probably benign
R0361:Syne2 UTSW 12 75918610 missense probably benign 0.22
R0363:Syne2 UTSW 12 76072207 missense probably damaging 0.98
R0367:Syne2 UTSW 12 75880177 missense probably damaging 1.00
R0371:Syne2 UTSW 12 75933845 missense probably damaging 1.00
R0374:Syne2 UTSW 12 75921226 nonsense probably null
R0388:Syne2 UTSW 12 75986975 missense probably benign 0.41
R0411:Syne2 UTSW 12 76059584 splice site probably null
R0432:Syne2 UTSW 12 75949064 missense probably damaging 0.99
R0469:Syne2 UTSW 12 75854149 critical splice donor site probably null
R0492:Syne2 UTSW 12 75982063 critical splice donor site probably null
R0496:Syne2 UTSW 12 76038940 missense possibly damaging 0.80
R0504:Syne2 UTSW 12 76033591 splice site probably benign
R0505:Syne2 UTSW 12 76099464 missense probably damaging 1.00
R0510:Syne2 UTSW 12 75854149 critical splice donor site probably null
R0518:Syne2 UTSW 12 76108862 critical splice acceptor site probably null
R0539:Syne2 UTSW 12 76024121 missense possibly damaging 0.69
R0552:Syne2 UTSW 12 75931004 missense probably benign 0.00
R0557:Syne2 UTSW 12 75929301 missense probably benign 0.04
R0567:Syne2 UTSW 12 75890230 missense probably damaging 0.98
R0599:Syne2 UTSW 12 76097960 nonsense probably null
R0602:Syne2 UTSW 12 76097960 nonsense probably null
R0608:Syne2 UTSW 12 75963813 missense probably damaging 1.00
R0614:Syne2 UTSW 12 75912353 splice site probably null
R0636:Syne2 UTSW 12 75930983 missense possibly damaging 0.75
R0647:Syne2 UTSW 12 75888203 missense probably benign
R0654:Syne2 UTSW 12 76097960 nonsense probably null
R0658:Syne2 UTSW 12 76094336 missense probably damaging 1.00
R0666:Syne2 UTSW 12 75923013 missense probably damaging 0.99
R0707:Syne2 UTSW 12 75982063 critical splice donor site probably null
R0714:Syne2 UTSW 12 76097960 nonsense probably null
R0841:Syne2 UTSW 12 76074435 splice site probably benign
R0848:Syne2 UTSW 12 76097959 frame shift probably null
R0848:Syne2 UTSW 12 76097960 nonsense probably null
R1103:Syne2 UTSW 12 76109835 missense probably benign 0.00
R1144:Syne2 UTSW 12 75966524 missense probably benign 0.04
R1194:Syne2 UTSW 12 75934513 missense probably damaging 1.00
R1247:Syne2 UTSW 12 75967490 missense probably benign 0.39
R1276:Syne2 UTSW 12 75941189 critical splice acceptor site probably null
R1343:Syne2 UTSW 12 76033643 missense probably damaging 1.00
R1442:Syne2 UTSW 12 75946715 missense probably damaging 1.00
R1448:Syne2 UTSW 12 76020325 splice site probably null
R1448:Syne2 UTSW 12 76052178 missense possibly damaging 0.56
R1522:Syne2 UTSW 12 76103783 missense probably damaging 0.98
R1528:Syne2 UTSW 12 75966100 missense probably benign 0.00
R1636:Syne2 UTSW 12 76004732 missense probably benign 0.01
R1637:Syne2 UTSW 12 75996002 missense probably damaging 1.00
R1650:Syne2 UTSW 12 75904259 nonsense probably null
R1654:Syne2 UTSW 12 76101094 missense possibly damaging 0.56
R1714:Syne2 UTSW 12 76054939 missense probably benign 0.26
R1750:Syne2 UTSW 12 76052805 missense probably damaging 1.00
R1772:Syne2 UTSW 12 75938729 missense probably benign 0.19
R1797:Syne2 UTSW 12 75963783 missense probably benign 0.00
R1830:Syne2 UTSW 12 76109862 missense probably damaging 1.00
R1837:Syne2 UTSW 12 75967660 missense probably damaging 0.99
R1908:Syne2 UTSW 12 76094279 critical splice acceptor site probably null
R1913:Syne2 UTSW 12 75899246 missense possibly damaging 0.60
R1944:Syne2 UTSW 12 76074544 missense probably damaging 1.00
R1950:Syne2 UTSW 12 75952870 missense probably benign
R1958:Syne2 UTSW 12 75969545 missense probably benign 0.11
R2018:Syne2 UTSW 12 76074579 missense probably damaging 1.00
R2037:Syne2 UTSW 12 76025569 missense probably benign 0.04
R2067:Syne2 UTSW 12 75888342 critical splice donor site probably null
R2073:Syne2 UTSW 12 76015579 missense possibly damaging 0.54
R2099:Syne2 UTSW 12 75979973 missense probably benign 0.06
R2102:Syne2 UTSW 12 76028079 missense probably benign 0.01
R2134:Syne2 UTSW 12 75952786 missense probably damaging 0.99
R2135:Syne2 UTSW 12 75952786 missense probably damaging 0.99
R2157:Syne2 UTSW 12 76094456 missense probably damaging 1.00
R2173:Syne2 UTSW 12 76100989 splice site probably benign
R2248:Syne2 UTSW 12 76096904 missense probably damaging 1.00
R2276:Syne2 UTSW 12 75927466 missense possibly damaging 0.87
R2277:Syne2 UTSW 12 75927466 missense possibly damaging 0.87
R2278:Syne2 UTSW 12 75927466 missense possibly damaging 0.87
R2279:Syne2 UTSW 12 75927466 missense possibly damaging 0.87
R2483:Syne2 UTSW 12 76095537 missense probably damaging 1.00
R2877:Syne2 UTSW 12 76000831 missense probably benign 0.00
R2884:Syne2 UTSW 12 75963759 missense probably benign 0.00
R3119:Syne2 UTSW 12 75909284 missense probably benign 0.01
R3499:Syne2 UTSW 12 76054978 splice site probably null
R3827:Syne2 UTSW 12 75987031 missense probably benign 0.02
R3847:Syne2 UTSW 12 76048622 missense probably damaging 1.00
R3849:Syne2 UTSW 12 76046065 nonsense probably null
R3850:Syne2 UTSW 12 76048622 missense probably damaging 1.00
R3859:Syne2 UTSW 12 75929784 missense possibly damaging 0.55
R3861:Syne2 UTSW 12 75966479 missense probably damaging 0.98
R4078:Syne2 UTSW 12 76035624 missense probably damaging 1.00
R4116:Syne2 UTSW 12 75931079 missense probably damaging 1.00
R4326:Syne2 UTSW 12 75952742 missense probably damaging 1.00
R4335:Syne2 UTSW 12 76028092 missense probably damaging 1.00
R4410:Syne2 UTSW 12 76094393 missense probably damaging 1.00
R4412:Syne2 UTSW 12 76106060 missense probably benign 0.01
R4444:Syne2 UTSW 12 76023030 missense probably damaging 1.00
R4595:Syne2 UTSW 12 75967071 missense possibly damaging 0.88
R4604:Syne2 UTSW 12 75967710 missense probably damaging 0.99
R4606:Syne2 UTSW 12 75989253 missense probably damaging 1.00
R4651:Syne2 UTSW 12 75989239 missense probably damaging 0.99
R4656:Syne2 UTSW 12 76031373 missense probably damaging 1.00
R4675:Syne2 UTSW 12 75949301 missense probably damaging 1.00
R4790:Syne2 UTSW 12 76020391 missense probably benign 0.19
R4791:Syne2 UTSW 12 75909244 missense possibly damaging 0.96
R4799:Syne2 UTSW 12 75899167 missense probably benign 0.04
R4836:Syne2 UTSW 12 75979819 missense probably damaging 1.00
R4880:Syne2 UTSW 12 75979819 missense probably damaging 1.00
R4881:Syne2 UTSW 12 75979819 missense probably damaging 1.00
R4899:Syne2 UTSW 12 75854101 missense probably benign 0.03
R4934:Syne2 UTSW 12 75899272 missense probably benign 0.14
R4981:Syne2 UTSW 12 75941219 missense probably damaging 0.98
R4996:Syne2 UTSW 12 75943950 missense possibly damaging 0.87
R5056:Syne2 UTSW 12 75909131 unclassified probably benign
R5066:Syne2 UTSW 12 75966551 missense probably benign 0.05
R5095:Syne2 UTSW 12 75952826 missense probably damaging 0.99
R5151:Syne2 UTSW 12 76043710 missense probably benign 0.06
R5193:Syne2 UTSW 12 76094420 missense probably damaging 1.00
R5267:Syne2 UTSW 12 75938741 missense possibly damaging 0.74
R5288:Syne2 UTSW 12 76099338 missense possibly damaging 0.94
R5402:Syne2 UTSW 12 76059439 missense probably damaging 0.98
R5434:Syne2 UTSW 12 75971875 missense probably damaging 1.00
R5441:Syne2 UTSW 12 75989143 missense possibly damaging 0.75
R5488:Syne2 UTSW 12 75888172 missense probably benign 0.13
R5497:Syne2 UTSW 12 75880389 missense probably benign 0.19
R5506:Syne2 UTSW 12 75938721 missense probably benign 0.01
R5509:Syne2 UTSW 12 75921244 missense probably damaging 1.00
R5518:Syne2 UTSW 12 75945170 missense possibly damaging 0.88
R5561:Syne2 UTSW 12 76094458 nonsense probably null
R5581:Syne2 UTSW 12 75945085 missense probably benign 0.01
R5625:Syne2 UTSW 12 76095112 missense probably benign 0.06
R5642:Syne2 UTSW 12 75918532 missense probably damaging 1.00
R5665:Syne2 UTSW 12 76108217 critical splice donor site probably null
R5666:Syne2 UTSW 12 75950959 missense probably benign 0.16
R5670:Syne2 UTSW 12 75950959 missense probably benign 0.16
R5691:Syne2 UTSW 12 76027856 frame shift probably null
R5696:Syne2 UTSW 12 75994145 missense probably benign 0.00
R5720:Syne2 UTSW 12 75967667 missense probably benign 0.03
R5739:Syne2 UTSW 12 75997465 missense possibly damaging 0.53
R5840:Syne2 UTSW 12 75880291 splice site probably null
R5846:Syne2 UTSW 12 76028124 missense probably benign 0.01
R5850:Syne2 UTSW 12 76097975 missense probably damaging 1.00
R5889:Syne2 UTSW 12 76072252 nonsense probably null
R5912:Syne2 UTSW 12 75908947 critical splice donor site probably null
R5931:Syne2 UTSW 12 76008865 missense probably benign 0.37
R5985:Syne2 UTSW 12 75966159 missense probably damaging 0.96
R5988:Syne2 UTSW 12 75929417 critical splice donor site probably null
R5990:Syne2 UTSW 12 76024144 missense probably benign 0.10
R6038:Syne2 UTSW 12 75878384 nonsense probably null
R6038:Syne2 UTSW 12 75878384 nonsense probably null
R6132:Syne2 UTSW 12 75945147 missense probably benign 0.14
R6136:Syne2 UTSW 12 75905325 missense probably benign 0.24
R6229:Syne2 UTSW 12 75921220 missense probably benign 0.00
R6252:Syne2 UTSW 12 75969436 missense probably benign 0.39
R6271:Syne2 UTSW 12 75890381 missense probably damaging 1.00
R6320:Syne2 UTSW 12 76061650 missense probably damaging 0.96
R6339:Syne2 UTSW 12 75989153 missense probably benign 0.34
R6380:Syne2 UTSW 12 76104980 missense probably damaging 0.98
R6394:Syne2 UTSW 12 75990495 missense probably benign 0.09
R6419:Syne2 UTSW 12 76096966 missense probably damaging 1.00
R6426:Syne2 UTSW 12 75923083 missense probably null 0.97
R6434:Syne2 UTSW 12 76041456 missense probably damaging 0.99
R6437:Syne2 UTSW 12 75990414 missense possibly damaging 0.87
R6466:Syne2 UTSW 12 75943901 missense probably damaging 0.97
R6501:Syne2 UTSW 12 76027847 splice site probably null
R6552:Syne2 UTSW 12 75890241 missense possibly damaging 0.89
R6744:Syne2 UTSW 12 76074447 missense probably damaging 1.00
R6810:Syne2 UTSW 12 75942885 missense probably benign 0.00
R6831:Syne2 UTSW 12 75966794 missense probably benign 0.39
R6861:Syne2 UTSW 12 75909266 missense probably damaging 1.00
R6875:Syne2 UTSW 12 76035630 missense probably damaging 0.99
R6892:Syne2 UTSW 12 75962528 missense probably damaging 0.98
R6899:Syne2 UTSW 12 76095729 splice site probably null
R6906:Syne2 UTSW 12 75995986 missense possibly damaging 0.93
R6909:Syne2 UTSW 12 76064195 missense probably benign 0.04
R6925:Syne2 UTSW 12 75854132 missense possibly damaging 0.58
R6949:Syne2 UTSW 12 75965997 missense probably benign 0.00
R6952:Syne2 UTSW 12 75927431 missense possibly damaging 0.76
R6996:Syne2 UTSW 12 76028012 missense probably damaging 0.99
R7080:Syne2 UTSW 12 76052727 missense probably benign 0.00
R7083:Syne2 UTSW 12 75943888 missense probably damaging 1.00
R7090:Syne2 UTSW 12 75942351 missense probably benign
R7144:Syne2 UTSW 12 76005378 missense probably benign 0.03
R7154:Syne2 UTSW 12 76059457 missense possibly damaging 0.63
R7177:Syne2 UTSW 12 75971880 nonsense probably null
R7190:Syne2 UTSW 12 76066587 missense probably benign 0.01
R7206:Syne2 UTSW 12 76004757 missense probably benign 0.02
R7208:Syne2 UTSW 12 76031398 splice site probably null
R7230:Syne2 UTSW 12 75933900 missense probably benign 0.12
R7260:Syne2 UTSW 12 75945079 missense probably damaging 1.00
R7272:Syne2 UTSW 12 76048643 missense probably benign 0.00
R7296:Syne2 UTSW 12 76103036 missense probably benign 0.00
R7322:Syne2 UTSW 12 75984024 missense probably damaging 1.00
R7329:Syne2 UTSW 12 75966984 missense probably benign 0.01
R7332:Syne2 UTSW 12 75967755 critical splice donor site probably null
R7381:Syne2 UTSW 12 75926489 missense probably benign 0.11
R7401:Syne2 UTSW 12 75967381 missense probably damaging 0.98
R7403:Syne2 UTSW 12 75915246 missense not run
R7429:Syne2 UTSW 12 75933996 missense probably damaging 1.00
R7429:Syne2 UTSW 12 76040410 nonsense probably null
R7430:Syne2 UTSW 12 75933996 missense probably damaging 1.00
R7430:Syne2 UTSW 12 76040410 nonsense probably null
R7438:Syne2 UTSW 12 76015563 missense probably benign 0.04
R7447:Syne2 UTSW 12 76028079 missense probably benign 0.01
R7466:Syne2 UTSW 12 76046186 missense possibly damaging 0.92
R7493:Syne2 UTSW 12 75965880 missense probably benign 0.00
R7502:Syne2 UTSW 12 76094326 missense probably damaging 1.00
R7543:Syne2 UTSW 12 75906842 missense possibly damaging 0.93
R7569:Syne2 UTSW 12 75927390 missense probably benign 0.00
R7599:Syne2 UTSW 12 75966371 missense probably benign 0.04
R7618:Syne2 UTSW 12 75945334 missense probably benign 0.01
R7639:Syne2 UTSW 12 75934499 missense probably damaging 1.00
R7698:Syne2 UTSW 12 75949064 missense probably damaging 0.99
R7702:Syne2 UTSW 12 75990387 missense probably benign 0.16
R7737:Syne2 UTSW 12 75942848 missense probably damaging 1.00
R7742:Syne2 UTSW 12 76059435 missense probably benign 0.02
R7753:Syne2 UTSW 12 76038923 missense probably benign 0.43
R7755:Syne2 UTSW 12 75997407 missense probably benign 0.19
R7757:Syne2 UTSW 12 76061779 missense possibly damaging 0.87
R7790:Syne2 UTSW 12 75929103 splice site probably null
R7808:Syne2 UTSW 12 75983727 splice site probably null
R7809:Syne2 UTSW 12 75967456 missense probably benign 0.00
R7811:Syne2 UTSW 12 75983727 splice site probably null
R7834:Syne2 UTSW 12 75967247 missense probably benign 0.00
R7853:Syne2 UTSW 12 76031504 missense probably damaging 1.00
R7867:Syne2 UTSW 12 75983727 splice site probably null
R7896:Syne2 UTSW 12 76035623 missense probably damaging 0.99
R7903:Syne2 UTSW 12 76064184 missense probably damaging 1.00
R7944:Syne2 UTSW 12 75904305 missense probably damaging 0.98
R7945:Syne2 UTSW 12 75904305 missense probably damaging 0.98
R7963:Syne2 UTSW 12 76020400 missense probably benign 0.38
R7996:Syne2 UTSW 12 76004667 missense probably damaging 1.00
R7998:Syne2 UTSW 12 76087858 missense probably damaging 1.00
R8010:Syne2 UTSW 12 75930738 missense probably benign 0.39
R8016:Syne2 UTSW 12 75942907 missense probably benign 0.19
R8140:Syne2 UTSW 12 75912353 missense possibly damaging 0.63
R8141:Syne2 UTSW 12 76061668 missense possibly damaging 0.66
R8206:Syne2 UTSW 12 76015591 missense probably benign 0.03
R8258:Syne2 UTSW 12 75949369 missense possibly damaging 0.95
R8259:Syne2 UTSW 12 75949369 missense possibly damaging 0.95
R8320:Syne2 UTSW 12 76103830 missense probably damaging 0.99
R8464:Syne2 UTSW 12 75965772 missense probably benign 0.39
R8465:Syne2 UTSW 12 75854124 missense possibly damaging 0.92
R8486:Syne2 UTSW 12 76042107 nonsense probably null
R8488:Syne2 UTSW 12 75965772 missense probably benign 0.39
R8511:Syne2 UTSW 12 76008873 missense probably benign 0.03
R8540:Syne2 UTSW 12 76094374 missense probably damaging 1.00
R8711:Syne2 UTSW 12 76057484 missense probably damaging 1.00
R8722:Syne2 UTSW 12 75925321 missense probably benign 0.04
R8827:Syne2 UTSW 12 76048583 missense probably benign 0.00
R8867:Syne2 UTSW 12 75942846 missense probably damaging 1.00
R8878:Syne2 UTSW 12 75905293 missense probably benign
R8924:Syne2 UTSW 12 75896670 missense probably damaging 0.97
R8966:Syne2 UTSW 12 76099423 missense probably damaging 1.00
R9007:Syne2 UTSW 12 76099450 missense possibly damaging 0.82
R9019:Syne2 UTSW 12 75952844 missense possibly damaging 0.93
R9057:Syne2 UTSW 12 75890393 missense probably damaging 1.00
R9067:Syne2 UTSW 12 75904220 missense probably damaging 1.00
R9081:Syne2 UTSW 12 75969516 nonsense probably null
R9091:Syne2 UTSW 12 75931060 missense probably damaging 1.00
R9123:Syne2 UTSW 12 75994064 missense probably damaging 1.00
R9147:Syne2 UTSW 12 75890384 missense probably damaging 1.00
R9148:Syne2 UTSW 12 75890384 missense probably damaging 1.00
R9163:Syne2 UTSW 12 75962575 missense possibly damaging 0.88
R9192:Syne2 UTSW 12 76109929 missense probably damaging 1.00
R9248:Syne2 UTSW 12 76107456 intron probably benign
R9270:Syne2 UTSW 12 75931060 missense probably damaging 1.00
R9292:Syne2 UTSW 12 75951049 missense probably benign
R9397:Syne2 UTSW 12 75994075 missense possibly damaging 0.59
R9454:Syne2 UTSW 12 76020501 missense probably damaging 0.99
R9454:Syne2 UTSW 12 76095070 nonsense probably null
R9478:Syne2 UTSW 12 76107613 missense probably damaging 0.96
R9492:Syne2 UTSW 12 75949065 missense possibly damaging 0.77
R9573:Syne2 UTSW 12 75880360 missense probably damaging 1.00
R9611:Syne2 UTSW 12 76033686 missense probably benign 0.05
R9623:Syne2 UTSW 12 75939986 missense probably benign 0.12
R9647:Syne2 UTSW 12 76105101 missense possibly damaging 0.55
R9652:Syne2 UTSW 12 76054846 missense probably benign 0.00
R9667:Syne2 UTSW 12 75880177 missense probably damaging 1.00
R9701:Syne2 UTSW 12 75990423 missense probably damaging 1.00
R9794:Syne2 UTSW 12 76000843 missense probably benign 0.04
R9802:Syne2 UTSW 12 75990423 missense probably damaging 1.00
X0019:Syne2 UTSW 12 75973287 missense probably benign 0.41
X0026:Syne2 UTSW 12 76101016 missense possibly damaging 0.78
X0061:Syne2 UTSW 12 75927511 critical splice donor site probably null
X0066:Syne2 UTSW 12 76096927 missense probably damaging 1.00
Z1176:Syne2 UTSW 12 75967541 missense probably benign 0.01
Z1176:Syne2 UTSW 12 76040383 missense possibly damaging 0.48
Z1177:Syne2 UTSW 12 75973423 missense probably damaging 1.00
Z1177:Syne2 UTSW 12 76064138 missense possibly damaging 0.51
Z1177:Syne2 UTSW 12 76097974 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGACACTTCTGAGCCAGCCC -3'
(R):5'- GTGTCCACTCCAGAATAACTGCCAC -3'

Sequencing Primer
(F):5'- Aacacacacacacacacacac -3'
(R):5'- CATGTGTCTCTTGGTTCAGC -3'
Posted On 2013-11-18