Mutagenetix > Incidental Mutations

Incidental Mutation 'R1077:Grk6'

85702

Institutional Source

Beutler Lab

Gene Symbol

Grk6

Ensembl Gene

ENSMUSG00000074886

Gene Name

G protein-coupled receptor kinase 6

Synonyms

Gprk6

MMRRC Submission

039163-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1077 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55445072-55460927 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 55454527 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000153668 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001115] [ENSMUST00000099482] [ENSMUST00000224118] [ENSMUST00000224653] [ENSMUST00000224995] [ENSMUST00000225925]

Predicted Effect

probably null
Transcript: ENSMUST00000001115

SMART Domains

Protein: ENSMUSP00000001115
Gene: ENSMUSG00000074886

Domain	Start	End	E-Value	Type
low complexity region	14	31	N/A	INTRINSIC
RGS	52	171	1.81e-34	SMART
S_TKc	186	448	8.4e-90	SMART
S_TK_X	449	528	2.8e-8	SMART
low complexity region	572	584	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000099482

SMART Domains

Protein: ENSMUSP00000097081
Gene: ENSMUSG00000074886

Domain	Start	End	E-Value	Type
low complexity region	14	31	N/A	INTRINSIC
RGS	52	171	1.81e-34	SMART
S_TKc	186	448	8.4e-90	SMART
S_TK_X	449	528	2.8e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185186

Predicted Effect

probably null
Transcript: ENSMUST00000224118

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224532

Predicted Effect

probably null
Transcript: ENSMUST00000224653

Predicted Effect

probably null
Transcript: ENSMUST00000224995

Predicted Effect

probably null
Transcript: ENSMUST00000225925

Meta Mutation Damage Score

0.9480

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.3%
20x: 94.6%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating their deactivation. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Whereas, homozygous mutant mice are viable and show no gross anatomical or behavioral abnormalites under normal physiological conditions, they exhibit locomotor supersensitivity to psychostimulants including cocaine and amphetamine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921528I07Rik	T	C	9: 114,301,702		noncoding transcript	Het
Apob	A	G	12: 8,006,017	K1500E	probably benign	Het
Atp8b1	A	T	18: 64,573,262	Y225*	probably null	Het
Cdc25c	A	T	18: 34,748,973		probably benign	Het
Ceacam15	T	C	7: 16,672,075	N184D	probably benign	Het
Cntln	T	C	4: 84,996,479	S508P	probably damaging	Het
Dhx34	A	G	7: 16,218,368	S111P	probably damaging	Het
Dst	A	G	1: 34,164,167	E759G	probably damaging	Het
Fis1	G	A	5: 136,965,146	A28T	probably damaging	Het
Fsd1	T	C	17: 55,990,542		probably null	Het
Gm15293	T	A	8: 21,202,433	F90Y	probably benign	Het
Il23r	A	T	6: 67,473,810	H228Q	probably benign	Het
Kcnh4	C	T	11: 100,752,338	V368I	possibly damaging	Het
Kdr	T	C	5: 75,956,231	E728G	probably damaging	Het
Krt33a	T	A	11: 100,015,937	M71L	probably benign	Het
Lrrc7	T	G	3: 158,161,143	D987A	probably damaging	Het
Naalad2	C	T	9: 18,347,506	R491Q	probably damaging	Het
Nedd4l	A	T	18: 65,167,499		probably benign	Het
Pramel7	A	G	2: 87,491,190	L167S	probably damaging	Het
Prkci	A	G	3: 31,050,192	D568G	probably damaging	Het
Psg18	G	A	7: 18,351,075	T32I	possibly damaging	Het
Ric8b	T	A	10: 84,970,717		probably benign	Het
Rnf213	T	C	11: 119,485,998		probably benign	Het
Rttn	T	C	18: 89,064,249	V1433A	probably damaging	Het
Sbf2	A	T	7: 110,367,172		probably benign	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Sfta2	T	C	17: 35,650,127		probably benign	Het
Slc17a1	T	A	13: 23,878,450		probably benign	Het
Slc6a21	G	A	7: 45,288,202	C314Y	probably benign	Het
Smpd4	T	C	16: 17,623,969	V35A	probably damaging	Het
Sorl1	T	C	9: 42,014,490	D1182G	probably damaging	Het
Syne2	A	G	12: 76,042,035	I5056V	possibly damaging	Het
Tex14	T	C	11: 87,519,745		probably benign	Het
Tex44	A	G	1: 86,427,055	T229A	probably benign	Het
Tfap2b	T	A	1: 19,234,149	C394*	probably null	Het
Ttk	T	A	9: 83,844,149		probably benign	Het
Vmn2r26	G	A	6: 124,053,913	V536I	probably benign	Het
Wac	A	G	18: 7,921,916	T553A	probably damaging	Het
Wdcp	T	A	12: 4,850,685	H180Q	probably damaging	Het
Wdr33	A	G	18: 31,835,461	H235R	probably benign	Het

Other mutations in Grk6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01733:Grk6	APN	13	55451391	missense	possibly damaging	0.92
IGL02054:Grk6	APN	13	55454397	missense	probably benign	0.03
IGL02156:Grk6	APN	13	55449361	missense	possibly damaging	0.86
IGL02442:Grk6	APN	13	55458937	splice site	probably benign
IGL02750:Grk6	APN	13	55451543	missense	probably damaging	1.00
IGL03340:Grk6	APN	13	55453190	missense	probably damaging	1.00
Damper	UTSW	13	55458920	missense	probably damaging	1.00
Piano	UTSW	13	55454527	critical splice donor site	probably null
R0080:Grk6	UTSW	13	55458910	missense	probably benign	0.00
R1530:Grk6	UTSW	13	55458799	missense	probably damaging	0.99
R1531:Grk6	UTSW	13	55452154	missense	probably damaging	1.00
R1733:Grk6	UTSW	13	55453166	splice site	probably benign
R1851:Grk6	UTSW	13	55451778	nonsense	probably null
R1874:Grk6	UTSW	13	55450273	missense	probably damaging	1.00
R2142:Grk6	UTSW	13	55454364	missense	probably damaging	1.00
R2875:Grk6	UTSW	13	55452304	missense	probably damaging	1.00
R5187:Grk6	UTSW	13	55451706	missense	probably damaging	1.00
R7010:Grk6	UTSW	13	55450300	missense	possibly damaging	0.74
R7104:Grk6	UTSW	13	55454406	missense	probably benign	0.36
R7111:Grk6	UTSW	13	55458920	missense	probably damaging	1.00
R7769:Grk6	UTSW	13	55451007	missense	probably benign	0.01
R7982:Grk6	UTSW	13	55451706	missense	probably damaging	1.00
R8401:Grk6	UTSW	13	55452168	missense	possibly damaging	0.95
R8468:Grk6	UTSW	13	55451385	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACACGTTCAGTCCTGACTGGTGG -3'
(R):5'- TGAAAGTGACTTGGCCCTTGCTC -3'

Sequencing Primer
(F):5'- GACTGGTGGGCGCTAGG -3'
(R):5'- TACATCAGGCTTAAAAGGTGGCTC -3'

Posted On

2013-11-18