Incidental Mutation 'R1077:Grk6'
ID 85702
Institutional Source Beutler Lab
Gene Symbol Grk6
Ensembl Gene ENSMUSG00000074886
Gene Name G protein-coupled receptor kinase 6
Synonyms Gprk6
MMRRC Submission 039163-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1077 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 55445072-55460927 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 55454527 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001115] [ENSMUST00000099482] [ENSMUST00000224118] [ENSMUST00000224653] [ENSMUST00000224995] [ENSMUST00000225925]
AlphaFold O70293
Predicted Effect probably null
Transcript: ENSMUST00000001115
SMART Domains Protein: ENSMUSP00000001115
Gene: ENSMUSG00000074886

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
RGS 52 171 1.81e-34 SMART
S_TKc 186 448 8.4e-90 SMART
S_TK_X 449 528 2.8e-8 SMART
low complexity region 572 584 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099482
SMART Domains Protein: ENSMUSP00000097081
Gene: ENSMUSG00000074886

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
RGS 52 171 1.81e-34 SMART
S_TKc 186 448 8.4e-90 SMART
S_TK_X 449 528 2.8e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185186
Predicted Effect probably null
Transcript: ENSMUST00000224118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224532
Predicted Effect probably null
Transcript: ENSMUST00000224653
Predicted Effect probably null
Transcript: ENSMUST00000224995
Predicted Effect probably null
Transcript: ENSMUST00000225925
Meta Mutation Damage Score 0.9480 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating their deactivation. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Whereas, homozygous mutant mice are viable and show no gross anatomical or behavioral abnormalites under normal physiological conditions, they exhibit locomotor supersensitivity to psychostimulants including cocaine and amphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik T C 9: 114,301,702 noncoding transcript Het
Apob A G 12: 8,006,017 K1500E probably benign Het
Atp8b1 A T 18: 64,573,262 Y225* probably null Het
Cdc25c A T 18: 34,748,973 probably benign Het
Ceacam15 T C 7: 16,672,075 N184D probably benign Het
Cntln T C 4: 84,996,479 S508P probably damaging Het
Dhx34 A G 7: 16,218,368 S111P probably damaging Het
Dst A G 1: 34,164,167 E759G probably damaging Het
Fis1 G A 5: 136,965,146 A28T probably damaging Het
Fsd1 T C 17: 55,990,542 probably null Het
Gm15293 T A 8: 21,202,433 F90Y probably benign Het
Il23r A T 6: 67,473,810 H228Q probably benign Het
Kcnh4 C T 11: 100,752,338 V368I possibly damaging Het
Kdr T C 5: 75,956,231 E728G probably damaging Het
Krt33a T A 11: 100,015,937 M71L probably benign Het
Lrrc7 T G 3: 158,161,143 D987A probably damaging Het
Naalad2 C T 9: 18,347,506 R491Q probably damaging Het
Nedd4l A T 18: 65,167,499 probably benign Het
Pramel7 A G 2: 87,491,190 L167S probably damaging Het
Prkci A G 3: 31,050,192 D568G probably damaging Het
Psg18 G A 7: 18,351,075 T32I possibly damaging Het
Ric8b T A 10: 84,970,717 probably benign Het
Rnf213 T C 11: 119,485,998 probably benign Het
Rttn T C 18: 89,064,249 V1433A probably damaging Het
Sbf2 A T 7: 110,367,172 probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sfta2 T C 17: 35,650,127 probably benign Het
Slc17a1 T A 13: 23,878,450 probably benign Het
Slc6a21 G A 7: 45,288,202 C314Y probably benign Het
Smpd4 T C 16: 17,623,969 V35A probably damaging Het
Sorl1 T C 9: 42,014,490 D1182G probably damaging Het
Syne2 A G 12: 76,042,035 I5056V possibly damaging Het
Tex14 T C 11: 87,519,745 probably benign Het
Tex44 A G 1: 86,427,055 T229A probably benign Het
Tfap2b T A 1: 19,234,149 C394* probably null Het
Ttk T A 9: 83,844,149 probably benign Het
Vmn2r26 G A 6: 124,053,913 V536I probably benign Het
Wac A G 18: 7,921,916 T553A probably damaging Het
Wdcp T A 12: 4,850,685 H180Q probably damaging Het
Wdr33 A G 18: 31,835,461 H235R probably benign Het
Other mutations in Grk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01733:Grk6 APN 13 55451391 missense possibly damaging 0.92
IGL02054:Grk6 APN 13 55454397 missense probably benign 0.03
IGL02156:Grk6 APN 13 55449361 missense possibly damaging 0.86
IGL02442:Grk6 APN 13 55458937 splice site probably benign
IGL02750:Grk6 APN 13 55451543 missense probably damaging 1.00
IGL03340:Grk6 APN 13 55453190 missense probably damaging 1.00
Damper UTSW 13 55458920 missense probably damaging 1.00
Piano UTSW 13 55454527 critical splice donor site probably null
R0080:Grk6 UTSW 13 55458910 missense probably benign 0.00
R1530:Grk6 UTSW 13 55458799 missense probably damaging 0.99
R1531:Grk6 UTSW 13 55452154 missense probably damaging 1.00
R1733:Grk6 UTSW 13 55453166 splice site probably benign
R1851:Grk6 UTSW 13 55451778 nonsense probably null
R1874:Grk6 UTSW 13 55450273 missense probably damaging 1.00
R2142:Grk6 UTSW 13 55454364 missense probably damaging 1.00
R2875:Grk6 UTSW 13 55452304 missense probably damaging 1.00
R5187:Grk6 UTSW 13 55451706 missense probably damaging 1.00
R7010:Grk6 UTSW 13 55450300 missense possibly damaging 0.74
R7104:Grk6 UTSW 13 55454406 missense probably benign 0.36
R7111:Grk6 UTSW 13 55458920 missense probably damaging 1.00
R7769:Grk6 UTSW 13 55451007 missense probably benign 0.01
R7982:Grk6 UTSW 13 55451706 missense probably damaging 1.00
R8401:Grk6 UTSW 13 55452168 missense possibly damaging 0.95
R8468:Grk6 UTSW 13 55451385 missense probably damaging 1.00
R9022:Grk6 UTSW 13 55459064 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TACACGTTCAGTCCTGACTGGTGG -3'
(R):5'- TGAAAGTGACTTGGCCCTTGCTC -3'

Sequencing Primer
(F):5'- GACTGGTGGGCGCTAGG -3'
(R):5'- TACATCAGGCTTAAAAGGTGGCTC -3'
Posted On 2013-11-18