Incidental Mutation 'R1077:Fsd1'
ID85705
Institutional Source Beutler Lab
Gene Symbol Fsd1
Ensembl Gene ENSMUSG00000011589
Gene Namefibronectin type 3 and SPRY domain-containing protein
Synonyms
MMRRC Submission 039163-MU
Accession Numbers

Genbank: NM_183178.2; Ensembl: ENSMUST00000011733

Is this an essential gene? Possibly non essential (E-score: 0.473) question?
Stock #R1077 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location55986511-55996881 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 55990542 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000011733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011733]
Predicted Effect probably null
Transcript: ENSMUST00000011733
SMART Domains Protein: ENSMUSP00000011733
Gene: ENSMUSG00000011589

DomainStartEndE-ValueType
BBC 4 130 7.61e-9 SMART
FN3 165 255 2.96e-4 SMART
Pfam:SPRY 355 473 6.3e-12 PFAM
Meta Mutation Damage Score 0.9509 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosome associated protein that is characterized by an N-terminal coiled-coil region downstream of B-box (BBC) domain, a central fibronectin type III domain, and a C-terminal repeats in splA and RyR (SPRY) domain. The encoded protein associates with a subset of microtubules and may be involved in the stability and organization of microtubules during cytokinesis. [provided by RefSeq, Apr 2009]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik T C 9: 114,301,702 noncoding transcript Het
Apob A G 12: 8,006,017 K1500E probably benign Het
Atp8b1 A T 18: 64,573,262 Y225* probably null Het
Cdc25c A T 18: 34,748,973 probably benign Het
Ceacam15 T C 7: 16,672,075 N184D probably benign Het
Cntln T C 4: 84,996,479 S508P probably damaging Het
Dhx34 A G 7: 16,218,368 S111P probably damaging Het
Dst A G 1: 34,164,167 E759G probably damaging Het
Fis1 G A 5: 136,965,146 A28T probably damaging Het
Gm15293 T A 8: 21,202,433 F90Y probably benign Het
Grk6 T C 13: 55,454,527 probably null Het
Il23r A T 6: 67,473,810 H228Q probably benign Het
Kcnh4 C T 11: 100,752,338 V368I possibly damaging Het
Kdr T C 5: 75,956,231 E728G probably damaging Het
Krt33a T A 11: 100,015,937 M71L probably benign Het
Lrrc7 T G 3: 158,161,143 D987A probably damaging Het
Naalad2 C T 9: 18,347,506 R491Q probably damaging Het
Nedd4l A T 18: 65,167,499 probably benign Het
Pramel7 A G 2: 87,491,190 L167S probably damaging Het
Prkci A G 3: 31,050,192 D568G probably damaging Het
Psg18 G A 7: 18,351,075 T32I possibly damaging Het
Ric8b T A 10: 84,970,717 probably benign Het
Rnf213 T C 11: 119,485,998 probably benign Het
Rttn T C 18: 89,064,249 V1433A probably damaging Het
Sbf2 A T 7: 110,367,172 probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sfta2 T C 17: 35,650,127 probably benign Het
Slc17a1 T A 13: 23,878,450 probably benign Het
Slc6a21 G A 7: 45,288,202 C314Y probably benign Het
Smpd4 T C 16: 17,623,969 V35A probably damaging Het
Sorl1 T C 9: 42,014,490 D1182G probably damaging Het
Syne2 A G 12: 76,042,035 I5056V possibly damaging Het
Tex14 T C 11: 87,519,745 probably benign Het
Tex44 A G 1: 86,427,055 T229A probably benign Het
Tfap2b T A 1: 19,234,149 C394* probably null Het
Ttk T A 9: 83,844,149 probably benign Het
Vmn2r26 G A 6: 124,053,913 V536I probably benign Het
Wac A G 18: 7,921,916 T553A probably damaging Het
Wdcp T A 12: 4,850,685 H180Q probably damaging Het
Wdr33 A G 18: 31,835,461 H235R probably benign Het
Other mutations in Fsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Fsd1 APN 17 55993943 critical splice donor site probably null
IGL01023:Fsd1 APN 17 55988245 missense probably damaging 1.00
IGL01382:Fsd1 APN 17 55996733 missense probably damaging 1.00
IGL01383:Fsd1 APN 17 55996733 missense probably damaging 1.00
IGL01384:Fsd1 APN 17 55996733 missense probably damaging 1.00
IGL01386:Fsd1 APN 17 55996733 missense probably damaging 1.00
IGL01387:Fsd1 APN 17 55996733 missense probably damaging 1.00
IGL01561:Fsd1 APN 17 55995363 missense probably benign
IGL02065:Fsd1 APN 17 55996499 missense probably damaging 1.00
IGL02172:Fsd1 APN 17 55990244 splice site probably benign
IGL02515:Fsd1 APN 17 55996303 missense probably null 1.00
IGL02674:Fsd1 APN 17 55996483 missense probably benign 0.04
IGL03135:Fsd1 APN 17 55990416 splice site probably null
IGL03380:Fsd1 APN 17 55995456 missense probably benign 0.00
emboldened UTSW 17 55990542 critical splice donor site probably null
1mM(1):Fsd1 UTSW 17 55988199 missense probably benign 0.26
R0201:Fsd1 UTSW 17 55990522 missense probably benign 0.00
R0521:Fsd1 UTSW 17 55991245 missense probably benign
R0718:Fsd1 UTSW 17 55996445 unclassified probably null
R1519:Fsd1 UTSW 17 55993870 missense probably benign 0.14
R1696:Fsd1 UTSW 17 55988257 critical splice donor site probably null
R1867:Fsd1 UTSW 17 55991254 missense probably benign 0.00
R2173:Fsd1 UTSW 17 55991223 missense possibly damaging 0.64
R3889:Fsd1 UTSW 17 55993893 missense probably benign 0.27
R3950:Fsd1 UTSW 17 55995517 critical splice donor site probably null
R4787:Fsd1 UTSW 17 55996257 missense possibly damaging 0.51
R4912:Fsd1 UTSW 17 55991241 missense possibly damaging 0.71
R4936:Fsd1 UTSW 17 55996452 missense possibly damaging 0.63
R5718:Fsd1 UTSW 17 55990542 critical splice donor site probably benign
R5749:Fsd1 UTSW 17 55995849 splice site probably null
R7077:Fsd1 UTSW 17 55993876 missense probably damaging 1.00
R7078:Fsd1 UTSW 17 55993876 missense probably damaging 1.00
R7091:Fsd1 UTSW 17 55993876 missense probably damaging 1.00
R7092:Fsd1 UTSW 17 55993876 missense probably damaging 1.00
R7137:Fsd1 UTSW 17 55993876 missense probably damaging 1.00
R7173:Fsd1 UTSW 17 55996696 missense possibly damaging 0.47
R7174:Fsd1 UTSW 17 55991356 missense probably benign 0.01
R7474:Fsd1 UTSW 17 55988149 missense possibly damaging 0.93
R7727:Fsd1 UTSW 17 55988150 missense probably benign 0.00
X0022:Fsd1 UTSW 17 55995464 nonsense probably null
Z1088:Fsd1 UTSW 17 55991203 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAGCACTGCACAGATACACATGG -3'
(R):5'- TTAGGATACACTGCCGAGAGAGCC -3'

Sequencing Primer
(F):5'- AGATGTCCCAGCCTGACC -3'
(R):5'- TCTGTGAACCTGCCTTGG -3'
Posted On2013-11-18