Incidental Mutation 'R1077:Wac'
ID85706
Institutional Source Beutler Lab
Gene Symbol Wac
Ensembl Gene ENSMUSG00000024283
Gene NameWW domain containing adaptor with coiled-coil
Synonyms1110067P07Rik, A230035H12Rik, Wwp4
MMRRC Submission 039163-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1077 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location7868832-7973547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7921916 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 553 (T553A)
Ref Sequence ENSEMBL: ENSMUSP00000128321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074919] [ENSMUST00000092112] [ENSMUST00000167020] [ENSMUST00000169478] [ENSMUST00000171042] [ENSMUST00000171486] [ENSMUST00000172018]
Predicted Effect probably benign
Transcript: ENSMUST00000074919
AA Change: T557A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074454
Gene: ENSMUSG00000024283
AA Change: T557A

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 287 307 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
low complexity region 466 481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092112
AA Change: T499A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000089746
Gene: ENSMUSG00000024283
AA Change: T499A

DomainStartEndE-ValueType
low complexity region 100 122 N/A INTRINSIC
WW 130 162 2.12e-7 SMART
low complexity region 229 249 N/A INTRINSIC
low complexity region 262 273 N/A INTRINSIC
low complexity region 408 423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165854
SMART Domains Protein: ENSMUSP00000126815
Gene: ENSMUSG00000024283

DomainStartEndE-ValueType
low complexity region 20 42 N/A INTRINSIC
WW 50 82 2.12e-7 SMART
low complexity region 265 280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167020
AA Change: T602A

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132117
Gene: ENSMUSG00000024283
AA Change: T602A

DomainStartEndE-ValueType
low complexity region 100 122 N/A INTRINSIC
WW 130 162 2.12e-7 SMART
low complexity region 252 267 N/A INTRINSIC
low complexity region 332 352 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 511 526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167542
SMART Domains Protein: ENSMUSP00000125989
Gene: ENSMUSG00000024283

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 95 115 N/A INTRINSIC
low complexity region 128 139 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169478
AA Change: T184A

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130467
Gene: ENSMUSG00000024283
AA Change: T184A

DomainStartEndE-ValueType
low complexity region 94 108 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171042
AA Change: T450A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133185
Gene: ENSMUSG00000024283
AA Change: T450A

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 184 204 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
low complexity region 359 374 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171486
AA Change: T451A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127848
Gene: ENSMUSG00000024283
AA Change: T451A

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 184 204 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
low complexity region 360 375 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172018
AA Change: T553A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128321
Gene: ENSMUSG00000024283
AA Change: T553A

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 287 307 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
Meta Mutation Damage Score 0.0843 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a WW domain, which is a protein module found in a wide range of signaling proteins. This domain mediates protein-protein interactions and binds proteins containing short linear peptide motifs that are proline-rich or contain at least one proline. This gene product shares 94% sequence identity with the WAC protein in mouse, however, its exact function is not known. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik T C 9: 114,301,702 noncoding transcript Het
Apob A G 12: 8,006,017 K1500E probably benign Het
Atp8b1 A T 18: 64,573,262 Y225* probably null Het
Cdc25c A T 18: 34,748,973 probably benign Het
Ceacam15 T C 7: 16,672,075 N184D probably benign Het
Cntln T C 4: 84,996,479 S508P probably damaging Het
Dhx34 A G 7: 16,218,368 S111P probably damaging Het
Dst A G 1: 34,164,167 E759G probably damaging Het
Fis1 G A 5: 136,965,146 A28T probably damaging Het
Fsd1 T C 17: 55,990,542 probably null Het
Gm15293 T A 8: 21,202,433 F90Y probably benign Het
Grk6 T C 13: 55,454,527 probably null Het
Il23r A T 6: 67,473,810 H228Q probably benign Het
Kcnh4 C T 11: 100,752,338 V368I possibly damaging Het
Kdr T C 5: 75,956,231 E728G probably damaging Het
Krt33a T A 11: 100,015,937 M71L probably benign Het
Lrrc7 T G 3: 158,161,143 D987A probably damaging Het
Naalad2 C T 9: 18,347,506 R491Q probably damaging Het
Nedd4l A T 18: 65,167,499 probably benign Het
Pramel7 A G 2: 87,491,190 L167S probably damaging Het
Prkci A G 3: 31,050,192 D568G probably damaging Het
Psg18 G A 7: 18,351,075 T32I possibly damaging Het
Ric8b T A 10: 84,970,717 probably benign Het
Rnf213 T C 11: 119,485,998 probably benign Het
Rttn T C 18: 89,064,249 V1433A probably damaging Het
Sbf2 A T 7: 110,367,172 probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sfta2 T C 17: 35,650,127 probably benign Het
Slc17a1 T A 13: 23,878,450 probably benign Het
Slc6a21 G A 7: 45,288,202 C314Y probably benign Het
Smpd4 T C 16: 17,623,969 V35A probably damaging Het
Sorl1 T C 9: 42,014,490 D1182G probably damaging Het
Syne2 A G 12: 76,042,035 I5056V possibly damaging Het
Tex14 T C 11: 87,519,745 probably benign Het
Tex44 A G 1: 86,427,055 T229A probably benign Het
Tfap2b T A 1: 19,234,149 C394* probably null Het
Ttk T A 9: 83,844,149 probably benign Het
Vmn2r26 G A 6: 124,053,913 V536I probably benign Het
Wdcp T A 12: 4,850,685 H180Q probably damaging Het
Wdr33 A G 18: 31,835,461 H235R probably benign Het
Other mutations in Wac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02404:Wac APN 18 7917570 missense probably damaging 1.00
R2915:Wac UTSW 18 7926131 missense possibly damaging 0.96
R3196:Wac UTSW 18 7917568 missense probably damaging 1.00
R3793:Wac UTSW 18 7920190 missense possibly damaging 0.86
R3840:Wac UTSW 18 7918535 missense probably damaging 1.00
R3971:Wac UTSW 18 7916175 missense probably damaging 1.00
R6402:Wac UTSW 18 7901585 missense possibly damaging 0.71
R6429:Wac UTSW 18 7920163 missense probably damaging 0.97
R6536:Wac UTSW 18 7905189 unclassified probably null
R6615:Wac UTSW 18 7868884 unclassified probably null
R6645:Wac UTSW 18 7973523 missense probably damaging 1.00
R7088:Wac UTSW 18 7921455 missense probably damaging 0.99
R7464:Wac UTSW 18 7871746 critical splice donor site probably null
R7760:Wac UTSW 18 7921913 missense probably benign 0.43
X0066:Wac UTSW 18 7916298 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCAGCGCACTTCAATGATAATCTCATA -3'
(R):5'- TCTGACTTCATAAGGCCATTCAAAACCA -3'

Sequencing Primer
(F):5'- TTAGTGTGTAAACATGAAGCTGG -3'
(R):5'- GCTCTCGCAAAGTTGCTTGA -3'
Posted On2013-11-18